\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312773945:

Variant ID: vg0312773945 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12773945
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTCGATCGGTGCGCCAGCTTCAGCTCCCGGTGCGCCATCTCCAGCTCCGGGTGCGCCATCTCCAGCTCCGGGTGCTGTAGCTCCAGACATGGTGATG[C/T]
AGATGAACGAACGACGAACAAGAGAAGAAGAGTAGTCGTGAGGAAGCACTCCCCCAAAACCTGATCACCCACCTACCCGATGCAGATCTCAGGCGAAGGT

Reverse complement sequence

ACCTTCGCCTGAGATCTGCATCGGGTAGGTGGGTGATCAGGTTTTGGGGGAGTGCTTCCTCACGACTACTCTTCTTCTCTTGTTCGTCGTTCGTTCATCT[G/A]
CATCACCATGTCTGGAGCTACAGCACCCGGAGCTGGAGATGGCGCACCCGGAGCTGGAGATGGCGCACCGGGAGCTGAAGCTGGCGCACCGATCGACAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.70% 0.51% 0.00% NA
All Indica  2759 99.50% 0.30% 0.29% 0.00% NA
All Japonica  1512 88.40% 10.80% 0.86% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 99.20% 0.40% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 68.70% 29.00% 2.38% 0.00% NA
Japonica Intermediate  241 92.90% 6.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312773945 C -> T LOC_Os03g22290.1 upstream_gene_variant ; 2044.0bp to feature; MODIFIER silent_mutation Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0312773945 C -> T LOC_Os03g22300.1 upstream_gene_variant ; 2977.0bp to feature; MODIFIER silent_mutation Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0312773945 C -> T LOC_Os03g22270-LOC_Os03g22290 intergenic_region ; MODIFIER silent_mutation Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312773945 1.82E-06 1.27E-08 mr1471 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 NA 1.32E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 2.88E-06 2.88E-06 mr1345_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 2.64E-06 3.48E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 NA 3.74E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 1.42E-06 1.54E-08 mr1653_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 NA 6.69E-06 mr1818_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 NA 3.59E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945 3.42E-08 2.09E-10 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251