Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0312773945:

Variant ID: vg0312773945 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12773945
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGTCGATCGGTGCGCCAGCTTCAGCTCCCGGTGCGCCATCTCCAGCTCCGGGTGCGCCATCTCCAGCTCCGGGTGCTGTAGCTCCAGACATGGTGATG[C/T]
AGATGAACGAACGACGAACAAGAGAAGAAGAGTAGTCGTGAGGAAGCACTCCCCCAAAACCTGATCACCCACCTACCCGATGCAGATCTCAGGCGAAGGT

Reverse complement sequence

ACCTTCGCCTGAGATCTGCATCGGGTAGGTGGGTGATCAGGTTTTGGGGGAGTGCTTCCTCACGACTACTCTTCTTCTCTTGTTCGTCGTTCGTTCATCT[G/A]
CATCACCATGTCTGGAGCTACAGCACCCGGAGCTGGAGATGGCGCACCCGGAGCTGGAGATGGCGCACCGGGAGCTGAAGCTGGCGCACCGATCGACAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	3.70%	0.51%	0.00%	NA
All Indica	2759	99.50%	0.30%	0.29%	0.00%	NA
All Japonica	1512	88.40%	10.80%	0.86%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.60%	0.20%	0.22%	0.00%	NA
Indica Intermediate	786	99.20%	0.40%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	68.70%	29.00%	2.38%	0.00%	NA
Japonica Intermediate	241	92.90%	6.60%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312773945	C -> T	LOC_Os03g22290.1	upstream_gene_variant ; 2044.0bp to feature; MODIFIER	silent_mutation	Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0312773945	C -> T	LOC_Os03g22300.1	upstream_gene_variant ; 2977.0bp to feature; MODIFIER	silent_mutation	Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0312773945	C -> T	LOC_Os03g22270-LOC_Os03g22290	intergenic_region ; MODIFIER	silent_mutation	Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312773945	1.82E-06	1.27E-08	mr1471	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	NA	1.32E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	2.88E-06	2.88E-06	mr1345_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	2.64E-06	3.48E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	NA	3.74E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	1.42E-06	1.54E-08	mr1653_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	NA	6.69E-06	mr1818_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	NA	3.59E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312773945	3.42E-08	2.09E-10	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251