\
| Variant ID: vg0312773945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12773945 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGTCGATCGGTGCGCCAGCTTCAGCTCCCGGTGCGCCATCTCCAGCTCCGGGTGCGCCATCTCCAGCTCCGGGTGCTGTAGCTCCAGACATGGTGATG[C/T]
AGATGAACGAACGACGAACAAGAGAAGAAGAGTAGTCGTGAGGAAGCACTCCCCCAAAACCTGATCACCCACCTACCCGATGCAGATCTCAGGCGAAGGT
ACCTTCGCCTGAGATCTGCATCGGGTAGGTGGGTGATCAGGTTTTGGGGGAGTGCTTCCTCACGACTACTCTTCTTCTCTTGTTCGTCGTTCGTTCATCT[G/A]
CATCACCATGTCTGGAGCTACAGCACCCGGAGCTGGAGATGGCGCACCCGGAGCTGGAGATGGCGCACCGGGAGCTGAAGCTGGCGCACCGATCGACAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.70% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 88.40% | 10.80% | 0.86% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 29.00% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312773945 | C -> T | LOC_Os03g22290.1 | upstream_gene_variant ; 2044.0bp to feature; MODIFIER | silent_mutation | Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0312773945 | C -> T | LOC_Os03g22300.1 | upstream_gene_variant ; 2977.0bp to feature; MODIFIER | silent_mutation | Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0312773945 | C -> T | LOC_Os03g22270-LOC_Os03g22290 | intergenic_region ; MODIFIER | silent_mutation | Average:65.56; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312773945 | 1.82E-06 | 1.27E-08 | mr1471 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | NA | 1.32E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | 2.88E-06 | 2.88E-06 | mr1345_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | 2.64E-06 | 3.48E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | NA | 3.74E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | 1.42E-06 | 1.54E-08 | mr1653_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | NA | 6.69E-06 | mr1818_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | NA | 3.59E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312773945 | 3.42E-08 | 2.09E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |