\
| Variant ID: vg0312772189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12772189 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAATATGGGAGAAGATAATGAGTCATACTTGTATGACACTTAAGATGCTAATTAGTAGTGGGTGATGAAATGACATACTTGTATGTTGAGTTTTAGTTT[C/T]
TAATAGGTGTTAGTGGGTGCCAACTACTCCCATCCGTTTCTAAATATTTGACGCCGTTGAATTTTTTAAATATGTTTGACCATTTGTCTTATTCAAAAAA
TTTTTTGAATAAGACAAATGGTCAAACATATTTAAAAAATTCAACGGCGTCAAATATTTAGAAACGGATGGGAGTAGTTGGCACCCACTAACACCTATTA[G/A]
AAACTAAAACTCAACATACAAGTATGTCATTTCATCACCCACTACTAATTAGCATCTTAAGTGTCATACAAGTATGACTCATTATCTTCTCCCATATTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 3.60% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 88.40% | 10.70% | 0.93% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 28.80% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312772189 | C -> T | LOC_Os03g22270.1 | upstream_gene_variant ; 3309.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0312772189 | C -> T | LOC_Os03g22290.1 | upstream_gene_variant ; 3800.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0312772189 | C -> T | LOC_Os03g22300.1 | upstream_gene_variant ; 4733.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0312772189 | C -> T | LOC_Os03g22270.2 | upstream_gene_variant ; 3309.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0312772189 | C -> T | LOC_Os03g22270.3 | upstream_gene_variant ; 3309.0bp to feature; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0312772189 | C -> T | LOC_Os03g22270-LOC_Os03g22290 | intergenic_region ; MODIFIER | silent_mutation | Average:57.882; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312772189 | 1.29E-06 | 8.60E-09 | mr1422_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312772189 | NA | 9.21E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312772189 | 5.44E-06 | 4.82E-08 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312772189 | 7.63E-10 | 6.60E-13 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |