\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312702703:

Variant ID: vg0312702703 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12702703
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTTTGACTGATAATTGATCTAAAATATTTTTTTGGTGTCATGTATGTAGTACCACTAGATTTGTATCTGAAAATATTTTCATATCATGTTAATTTC[A/G]
AAGTACCCCAGTTAATAATATATTACTACCCCTGTCCTAAAATGTATGACACCGTTGACTTTTCGCATAATGTTTGACCATTCGTCTTAAAATTTTAGTG

Reverse complement sequence

CACTAAAATTTTAAGACGAATGGTCAAACATTATGCGAAAAGTCAACGGTGTCATACATTTTAGGACAGGGGTAGTAATATATTATTAACTGGGGTACTT[T/C]
GAAATTAACATGATATGAAAATATTTTCAGATACAAATCTAGTGGTACTACATACATGACACCAAAAAAATATTTTAGATCAATTATCAGTCAAAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 3.40% 1.16% 0.00% NA
All Indica  2759 98.90% 0.00% 1.12% 0.00% NA
All Japonica  1512 88.30% 10.20% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 0.00% 3.03% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.00% 1.53% 0.00% NA
Temperate Japonica  767 99.20% 0.40% 0.39% 0.00% NA
Tropical Japonica  504 69.00% 28.00% 2.98% 0.00% NA
Japonica Intermediate  241 93.80% 4.10% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312702703 A -> G LOC_Os03g22160.1 intron_variant ; MODIFIER silent_mutation Average:50.609; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312702703 2.11E-06 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 9.24E-06 NA mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 5.28E-06 5.28E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 2.12E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 5.75E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 3.10E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 2.64E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 3.57E-07 7.99E-14 mr1241 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 1.84E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 3.41E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 6.26E-08 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 6.35E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 2.24E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312702703 NA 3.70E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251