\
| Variant ID: vg0312702703 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12702703 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )
AAAACTTTGACTGATAATTGATCTAAAATATTTTTTTGGTGTCATGTATGTAGTACCACTAGATTTGTATCTGAAAATATTTTCATATCATGTTAATTTC[A/G]
AAGTACCCCAGTTAATAATATATTACTACCCCTGTCCTAAAATGTATGACACCGTTGACTTTTCGCATAATGTTTGACCATTCGTCTTAAAATTTTAGTG
CACTAAAATTTTAAGACGAATGGTCAAACATTATGCGAAAAGTCAACGGTGTCATACATTTTAGGACAGGGGTAGTAATATATTATTAACTGGGGTACTT[T/C]
GAAATTAACATGATATGAAAATATTTTCAGATACAAATCTAGTGGTACTACATACATGACACCAAAAAAATATTTTAGATCAATTATCAGTCAAAGTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 3.40% | 1.16% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 88.30% | 10.20% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 0.00% | 3.03% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.00% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 69.00% | 28.00% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 4.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312702703 | A -> G | LOC_Os03g22160.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.609; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312702703 | 2.11E-06 | NA | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | 9.24E-06 | NA | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | 5.28E-06 | 5.28E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 2.12E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 5.75E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 3.10E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 2.64E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | 3.57E-07 | 7.99E-14 | mr1241 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 1.84E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 3.41E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 6.26E-08 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 6.35E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 2.24E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312702703 | NA | 3.70E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |