RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0312535741:

Variant ID: vg0312535741 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12535741
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCGCGCGGCCGCTAGGGATGAAAACGGAGCGGATACGGACGGATAATGCTCATACCATATTCGTTTTCATATTTTTTGCCGGATACGGAAACAAATAC[G/A]
GATAGCTCGAATACGGAAACAAATACGGACTATCTCGAATACGAATAAGAATCGAATATGATCGGACACGAATACGGAAACAAATTTTTCTCGGAACACG

Reverse complement sequence

CGTGTTCCGAGAAAAATTTGTTTCCGTATTCGTGTCCGATCATATTCGATTCTTATTCGTATTCGAGATAGTCCGTATTTGTTTCCGTATTCGAGCTATC[C/T]
GTATTTGTTTCCGTATCCGGCAAAAAATATGAAAACGAATATGGTATGAGCATTATCCGTCCGTATCCGCTCCGTTTTCATCCCTAGCGGCCGCGCGCGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.40%	0.17%	0.00%	NA
All Indica	2759	85.60%	14.10%	0.22%	0.00%	NA
All Japonica	1512	1.70%	98.20%	0.07%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	78.70%	21.20%	0.17%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	87.40%	12.60%	0.00%	0.00%	NA
Indica Intermediate	786	81.40%	18.10%	0.51%	0.00%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	34.40%	64.40%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312535741	G -> A	LOC_Os03g21900.1	downstream_gene_variant ; 3043.0bp to feature; MODIFIER	silent_mutation	Average:44.216; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0312535741	G -> A	LOC_Os03g21930.1	downstream_gene_variant ; 4837.0bp to feature; MODIFIER	silent_mutation	Average:44.216; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0312535741	G -> A	LOC_Os03g21914.1	intron_variant ; MODIFIER	silent_mutation	Average:44.216; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312535741	NA	9.08E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	1.91E-06	1.06E-07	mr1117	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	NA	7.68E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	NA	1.81E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	NA	5.90E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	6.28E-06	6.28E-06	mr1313	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	NA	8.67E-10	mr1321	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	1.65E-06	1.65E-06	mr1321	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	1.99E-06	1.99E-06	mr1323	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312535741	8.23E-06	8.23E-06	mr1331	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 40 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0312535741:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact