Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312533516:

Variant ID: vg0312533516 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 12533516
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, A: 0.38, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCAACAAAAATGTGTAGCTATTGTCATTTCAGTTTGACACCATTGCCATTCTAGTAGCTCGGGTGATTTGCAAGGAACGAACGAAACAATAGAGCGTTTA[A/T]
CAGCGAATGCAAGGTATCCTGAAAACAACATATCAAGTAGCATTTTATCCTGAAAACATTGTATCAAGTGGCATTTTATCTGGTTTATTCTAGTGGGTGA

Reverse complement sequence

TCACCCACTAGAATAAACCAGATAAAATGCCACTTGATACAATGTTTTCAGGATAAAATGCTACTTGATATGTTGTTTTCAGGATACCTTGCATTCGCTG[T/A]
TAAACGCTCTATTGTTTCGTTCGTTCCTTGCAAATCACCCGAGCTACTAGAATGGCAATGGTGTCAAACTGAAATGACAATAGCTACACATTTTTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.50%	0.06%	0.00%	NA
All Indica	2759	95.80%	4.10%	0.04%	0.00%	NA
All Japonica	1512	1.70%	98.30%	0.07%	0.00%	NA
Aus	269	50.60%	49.40%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	94.20%	5.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	4.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.50%	99.30%	0.13%	0.00%	NA
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0312533516	A -> T	LOC_Os03g21890.1	downstream_gene_variant ; 4633.0bp to feature; MODIFIER	silent_mutation	Average:75.361; most accessible tissue: Callus, score: 88.167	N	N	N	N
vg0312533516	A -> T	LOC_Os03g21900.1	downstream_gene_variant ; 818.0bp to feature; MODIFIER	silent_mutation	Average:75.361; most accessible tissue: Callus, score: 88.167	N	N	N	N
vg0312533516	A -> T	LOC_Os03g21914.1	downstream_gene_variant ; 137.0bp to feature; MODIFIER	silent_mutation	Average:75.361; most accessible tissue: Callus, score: 88.167	N	N	N	N
vg0312533516	A -> T	LOC_Os03g21900-LOC_Os03g21914	intergenic_region ; MODIFIER	silent_mutation	Average:75.361; most accessible tissue: Callus, score: 88.167	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0312533516	NA	5.38E-27	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	5.41E-49	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	1.50E-19	mr1627	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	7.33E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	8.82E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	1.27E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	1.86E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	1.35E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516	NA	2.78E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251