\
| Variant ID: vg0312533516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 12533516 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, A: 0.38, others allele: 0.00, population size: 259. )
CCAACAAAAATGTGTAGCTATTGTCATTTCAGTTTGACACCATTGCCATTCTAGTAGCTCGGGTGATTTGCAAGGAACGAACGAAACAATAGAGCGTTTA[A/T]
CAGCGAATGCAAGGTATCCTGAAAACAACATATCAAGTAGCATTTTATCCTGAAAACATTGTATCAAGTGGCATTTTATCTGGTTTATTCTAGTGGGTGA
TCACCCACTAGAATAAACCAGATAAAATGCCACTTGATACAATGTTTTCAGGATAAAATGCTACTTGATATGTTGTTTTCAGGATACCTTGCATTCGCTG[T/A]
TAAACGCTCTATTGTTTCGTTCGTTCCTTGCAAATCACCCGAGCTACTAGAATGGCAATGGTGTCAAACTGAAATGACAATAGCTACACATTTTTGTTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0312533516 | A -> T | LOC_Os03g21890.1 | downstream_gene_variant ; 4633.0bp to feature; MODIFIER | silent_mutation | Average:75.361; most accessible tissue: Callus, score: 88.167 | N | N | N | N |
| vg0312533516 | A -> T | LOC_Os03g21900.1 | downstream_gene_variant ; 818.0bp to feature; MODIFIER | silent_mutation | Average:75.361; most accessible tissue: Callus, score: 88.167 | N | N | N | N |
| vg0312533516 | A -> T | LOC_Os03g21914.1 | downstream_gene_variant ; 137.0bp to feature; MODIFIER | silent_mutation | Average:75.361; most accessible tissue: Callus, score: 88.167 | N | N | N | N |
| vg0312533516 | A -> T | LOC_Os03g21900-LOC_Os03g21914 | intergenic_region ; MODIFIER | silent_mutation | Average:75.361; most accessible tissue: Callus, score: 88.167 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0312533516 | NA | 5.38E-27 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 5.41E-49 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 1.50E-19 | mr1627 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 7.33E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 8.82E-25 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 1.27E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 1.86E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 1.35E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0312533516 | NA | 2.78E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |