\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312533516:

Variant ID: vg0312533516 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12533516
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, A: 0.38, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCAACAAAAATGTGTAGCTATTGTCATTTCAGTTTGACACCATTGCCATTCTAGTAGCTCGGGTGATTTGCAAGGAACGAACGAAACAATAGAGCGTTTA[A/T]
CAGCGAATGCAAGGTATCCTGAAAACAACATATCAAGTAGCATTTTATCCTGAAAACATTGTATCAAGTGGCATTTTATCTGGTTTATTCTAGTGGGTGA

Reverse complement sequence

TCACCCACTAGAATAAACCAGATAAAATGCCACTTGATACAATGTTTTCAGGATAAAATGCTACTTGATATGTTGTTTTCAGGATACCTTGCATTCGCTG[T/A]
TAAACGCTCTATTGTTTCGTTCGTTCCTTGCAAATCACCCGAGCTACTAGAATGGCAATGGTGTCAAACTGAAATGACAATAGCTACACATTTTTGTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.50% 0.06% 0.00% NA
All Indica  2759 95.80% 4.10% 0.04% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.07% 0.00% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 94.20% 5.80% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.30% 0.13% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312533516 A -> T LOC_Os03g21890.1 downstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:75.361; most accessible tissue: Callus, score: 88.167 N N N N
vg0312533516 A -> T LOC_Os03g21900.1 downstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:75.361; most accessible tissue: Callus, score: 88.167 N N N N
vg0312533516 A -> T LOC_Os03g21914.1 downstream_gene_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:75.361; most accessible tissue: Callus, score: 88.167 N N N N
vg0312533516 A -> T LOC_Os03g21900-LOC_Os03g21914 intergenic_region ; MODIFIER silent_mutation Average:75.361; most accessible tissue: Callus, score: 88.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312533516 NA 5.38E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 5.41E-49 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 1.50E-19 mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 7.33E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 8.82E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 1.27E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 1.86E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 1.35E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312533516 NA 2.78E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251