Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312470741:

Variant ID: vg0312470741 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12470741
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCTGGCACTGCGTAGGGATTTGGATCCTTCTTCGTTGAGTGTGACCTTTAAGTGTGTTTTTGGCTGCATCCAAAGTTTAGATTTTGGTTGAAATTAGA[G/A]
ATGATGTGACTAAAAAGTTATGTGTGTATGATAGGTTGATGTGATAGAAAATGACTGAAGTTTGGATACAAACTTTGGATCTAAACATAGCCTTTATAAA

Reverse complement sequence

TTTATAAAGGCTATGTTTAGATCCAAAGTTTGTATCCAAACTTCAGTCATTTTCTATCACATCAACCTATCATACACACATAACTTTTTAGTCACATCAT[C/T]
TCTAATTTCAACCAAAATCTAAACTTTGGATGCAGCCAAAAACACACTTAAAGGTCACACTCAACGAAGAAGGATCCAAATCCCTACGCAGTGCCAGCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 44.10% 0.08% 0.15% NA
All Indica  2759 93.40% 6.30% 0.04% 0.22% NA
All Japonica  1512 0.60% 99.30% 0.07% 0.07% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 98.10% 1.50% 0.00% 0.43% NA
Indica III  913 92.30% 7.40% 0.00% 0.22% NA
Indica Intermediate  786 91.20% 8.40% 0.13% 0.25% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312470741 G -> A LOC_Os03g21820.1 upstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:88.769; most accessible tissue: Zhenshan97 flower, score: 96.841 N N N N
vg0312470741 G -> A LOC_Os03g21810.1 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:88.769; most accessible tissue: Zhenshan97 flower, score: 96.841 N N N N
vg0312470741 G -> A LOC_Os03g21820-LOC_Os03g21830 intergenic_region ; MODIFIER silent_mutation Average:88.769; most accessible tissue: Zhenshan97 flower, score: 96.841 N N N N
vg0312470741 G -> DEL N N silent_mutation Average:88.769; most accessible tissue: Zhenshan97 flower, score: 96.841 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0312470741 G A -0.02 0.0 0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312470741 NA 7.66E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.66E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.76E-50 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.15E-50 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 1.74E-06 NA mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 4.99E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 6.27E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.57E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 3.60E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 6.78E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 3.37E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.41E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 6.23E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 5.56E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.84E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.36E-25 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 8.29E-20 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 4.31E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 5.07E-64 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 9.70E-81 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 8.42E-47 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 7.28E-59 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.03E-59 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.46E-37 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.39E-37 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 3.83E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.01E-20 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.17E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 3.97E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.05E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.89E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 6.41E-17 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 4.80E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 3.74E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 2.73E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312470741 NA 1.21E-102 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251