\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312184618:

Variant ID: vg0312184618 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12184618
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGCGCAGGCTCGTCGAGGGGCCCGCTGCCGCACACGATGTCGTATACGCCGTGCTCCGGTCGTCCGTCCGCACGGCGATGGTGGTCCGTCCCAAGGCC[G/A]
CGGCAAATGGAGGCAGAGGGGTAGAGAGACGGCACGGAGGGGGAGGGAGTAGAAAAATCTGGCGGCCTCCTCCGAGTCCGACTGGGTCGCGGCCGGAGGT

Reverse complement sequence

ACCTCCGGCCGCGACCCAGTCGGACTCGGAGGAGGCCGCCAGATTTTTCTACTCCCTCCCCCTCCGTGCCGTCTCTCTACCCCTCTGCCTCCATTTGCCG[C/T]
GGCCTTGGGACGGACCACCATCGCCGTGCGGACGGACGACCGGAGCACGGCGTATACGACATCGTGTGCGGCAGCGGGCCCCTCGACGAGCCTGCGCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 0.40% 1.27% 56.31% NA
All Indica  2759 6.70% 0.70% 2.10% 90.43% NA
All Japonica  1512 99.50% 0.00% 0.07% 0.46% NA
Aus  269 52.00% 0.00% 0.37% 47.58% NA
Indica I  595 6.40% 0.70% 1.68% 91.26% NA
Indica II  465 2.20% 1.30% 1.72% 94.84% NA
Indica III  913 6.00% 0.40% 2.41% 91.13% NA
Indica Intermediate  786 10.60% 0.80% 2.29% 86.39% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 66.70% 0.00% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312184618 G -> A LOC_Os03g21300.1 missense_variant ; p.Ala8Thr; MODERATE nonsynonymous_codon ; A8T Average:69.121; most accessible tissue: Zhenshan97 flag leaf, score: 85.259 unknown unknown DELETERIOUS 0.00
vg0312184618 G -> DEL LOC_Os03g21300.1 N frameshift_variant Average:69.121; most accessible tissue: Zhenshan97 flag leaf, score: 85.259 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0312184618 G A -0.07 -0.05 -0.06 -0.06 -0.06 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312184618 NA 2.84E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 7.75E-06 7.72E-06 mr1012 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 8.16E-06 mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 2.26E-06 mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 7.22E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 7.18E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 4.97E-06 NA mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 3.12E-06 3.12E-06 mr1369_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 7.09E-06 NA mr1453_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 1.87E-06 1.87E-06 mr1453_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 2.42E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312184618 NA 9.49E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251