Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0312113974:

Variant ID: vg0312113974 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 12113974
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAAAATAGATCATTATAAAAAATTAAAAAATAGATTTATTTTATATTTTAGATCAAATGTAGAAAGTTTTCACATAAAAAGTACCATTTAGTAGCTT[G/A]
AAAATCATGTTAATATGTACTACTATCTCTGTCCAATTATAAGCGCAGTTATGAGTTTTCGTGTCCAATCTTGATAGTCCGTTATATTTGAAATTTTTTT

Reverse complement sequence

AAAAAAATTTCAAATATAACGGACTATCAAGATTGGACACGAAAACTCATAACTGCGCTTATAATTGGACAGAGATAGTAGTACATATTAACATGATTTT[C/T]
AAGCTACTAAATGGTACTTTTTATGTGAAAACTTTCTACATTTGATCTAAAATATAAAATAAATCTATTTTTTAATTTTTTATAATGATCTATTTTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.90% 0.23% 0.00% NA
All Indica  2759 96.20% 3.50% 0.29% 0.00% NA
All Japonica  1512 0.80% 99.10% 0.13% 0.00% NA
Aus  269 29.00% 70.60% 0.37% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 95.20% 4.60% 0.22% 0.00% NA
Indica Intermediate  786 93.80% 5.90% 0.38% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0312113974 G -> A LOC_Os03g21220.1 upstream_gene_variant ; 3000.0bp to feature; MODIFIER silent_mutation Average:22.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0312113974 G -> A LOC_Os03g21230.1 upstream_gene_variant ; 3837.0bp to feature; MODIFIER silent_mutation Average:22.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0312113974 G -> A LOC_Os03g21220-LOC_Os03g21230 intergenic_region ; MODIFIER silent_mutation Average:22.453; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0312113974 NA 3.33E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 8.72E-50 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 4.35E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 5.54E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 2.91E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 2.29E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 5.65E-06 NA mr1819 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 9.13E-19 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 6.40E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 1.36E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 1.88E-79 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 6.61E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 3.91E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 2.56E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 2.06E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 5.25E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 7.74E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 8.20E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 1.96E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 7.28E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 3.37E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 6.06E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0312113974 NA 4.61E-98 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251