\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311861697:

Variant ID: vg0311861697 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11861697
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAAGGACTATATCAGTATGTACCGCAAAAGTTTAAATTGATCCGAGAGCGAAAACTGTATGAATTATGTTGGCTATTTCTTTCATTTACAAACTTATT[C/A]
TTGATGGTCAAATTTTTAAAATTTTAGCCAAATATTGTCTTATTAAATACTCCATATCTATGATTAGAGAGAGAGAGAGAGAGAGAGAGTATAACGTACA

Reverse complement sequence

TGTACGTTATACTCTCTCTCTCTCTCTCTCTCTCTAATCATAGATATGGAGTATTTAATAAGACAATATTTGGCTAAAATTTTAAAAATTTGACCATCAA[G/T]
AATAAGTTTGTAAATGAAAGAAATAGCCAACATAATTCATACAGTTTTCGCTCTCGGATCAATTTAAACTTTTGCGGTACATACTGATATAGTCCTTAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 3.70% 0.89% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 86.60% 10.90% 2.45% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 63.90% 30.60% 5.56% 0.00% NA
Japonica Intermediate  241 92.50% 4.60% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 5.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311861697 C -> A LOC_Os03g20910-LOC_Os03g20920 intergenic_region ; MODIFIER silent_mutation Average:45.192; most accessible tissue: Callus, score: 89.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311861697 NA 3.83E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 8.32E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 2.60E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 8.65E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 5.41E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 5.01E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 5.76E-06 9.36E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 1.04E-07 7.36E-11 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311861697 NA 1.91E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251