Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311723715:

Variant ID: vg0311723715 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11723715
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATGATCTAATGTTAGGGCATTCCCAACCCAAGACACTAACATAGTTTCCATAAACTCCACATCATCAACAAACTAGTACTAGATACTACTCTTCCAAT[A/G]
CAAACACTACTATTATATACTTAAATTTAATACTACTTATCTCACATAATGTCTTGGATGTTGTGTAGAAACCATGTCTCATGCAAGATATTGTTTACTT

Reverse complement sequence

AAGTAAACAATATCTTGCATGAGACATGGTTTCTACACAACATCCAAGACATTATGTGAGATAAGTAGTATTAAATTTAAGTATATAATAGTAGTGTTTG[T/C]
ATTGGAAGAGTAGTATCTAGTACTAGTTTGTTGATGATGTGGAGTTTATGGAAACTATGTTAGTGTCTTGGGTTGGGAATGCCCTAACATTAGATCATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.70%	8.90%	14.92%	47.52%	NA
All Indica	2759	12.20%	9.10%	17.54%	61.15%	NA
All Japonica	1512	62.30%	8.50%	7.61%	21.56%	NA
Aus	269	14.10%	6.30%	25.65%	53.90%	NA
Indica I	595	4.20%	16.50%	26.55%	52.77%	NA
Indica II	465	9.90%	4.50%	13.76%	71.83%	NA
Indica III	913	19.10%	5.90%	10.62%	64.40%	NA
Indica Intermediate	786	11.70%	9.90%	20.99%	57.38%	NA
Temperate Japonica	767	98.60%	0.00%	0.26%	1.17%	NA
Tropical Japonica	504	4.80%	23.00%	19.25%	52.98%	NA
Japonica Intermediate	241	67.20%	5.40%	6.64%	20.75%	NA
VI/Aromatic	96	8.30%	13.50%	21.88%	56.25%	NA
Intermediate	90	32.20%	12.20%	17.78%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311723715	A -> DEL	N	N	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N
vg0311723715	A -> G	LOC_Os03g20710.1	upstream_gene_variant ; 2456.0bp to feature; MODIFIER	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N
vg0311723715	A -> G	LOC_Os03g20720.1	upstream_gene_variant ; 1280.0bp to feature; MODIFIER	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N
vg0311723715	A -> G	LOC_Os03g20700.1	downstream_gene_variant ; 3584.0bp to feature; MODIFIER	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N
vg0311723715	A -> G	LOC_Os03g20700.2	downstream_gene_variant ; 4165.0bp to feature; MODIFIER	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N
vg0311723715	A -> G	LOC_Os03g20710-LOC_Os03g20720	intergenic_region ; MODIFIER	silent_mutation	Average:72.113; most accessible tissue: Zhenshan97 flower, score: 90.356	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311723715	NA	2.16E-42	Grain_thickness	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311723715	NA	1.84E-14	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311723715	NA	6.68E-63	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311723715	NA	1.10E-13	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311723715	NA	1.06E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.36E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	7.25E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	9.59E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.20E-42	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.10E-41	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.12E-23	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.48E-16	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.16E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.42E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.01E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.91E-40	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.58E-56	mr1241	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.43E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.82E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.83E-19	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.26E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.84E-93	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.20E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.25E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.40E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.52E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.77E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.08E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.72E-22	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.36E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	7.03E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.02E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.74E-21	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.11E-45	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.49E-72	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.48E-37	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.99E-34	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.46E-14	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.19E-24	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.97E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.83E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.01E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.39E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.69E-08	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.95E-14	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.71E-15	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.76E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.38E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.20E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.46E-73	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.74E-52	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.64E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.01E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.41E-52	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.25E-62	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.12E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.68E-14	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.24E-24	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.40E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.20E-24	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	9.47E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.04E-108	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.67E-24	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.39E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.59E-10	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.47E-36	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.59E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	7.00E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.00E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.48E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	9.17E-31	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	2.12E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.79E-22	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.24E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.98E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	9.18E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.61E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.71E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.43E-17	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	8.37E-40	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.53E-75	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.09E-45	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.90E-30	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.07E-06	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	7.46E-14	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.31E-43	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.30E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	6.04E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.38E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	3.42E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.36E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	5.92E-54	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	4.26E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311723715	NA	1.07E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251