\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311656964:

Variant ID: vg0311656964 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 11656964
Reference Allele: TAlternative Allele: C,TCAACTCACTCTTACACCTATAATTCATCTACCCTATAATTCATCAACTCACTCTTACACCTACATTACTC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTCTAAATACTGTCTAGCTGATATAGATAGTCACATTACAGAAAAATCTAGATAAATGAACTCACTCTTACACCTATAATTCATCTACCCTATAATT[T/C,TCAACTCACTCTTACACCTATAATTCATCTACCCTATAATTCATCAACTCACTCTTACACCTACATTACTC]
ATCAACTCACTCTTACACCTACATTACTCATTCATCAAATCCAGCTGACAGTATTCCTCAGTGCCCGATCTAACGATCATCGCGTCCACCTCAGTAGTGT

Reverse complement sequence

ACACTACTGAGGTGGACGCGATGATCGTTAGATCGGGCACTGAGGAATACTGTCAGCTGGATTTGATGAATGAGTAATGTAGGTGTAAGAGTGAGTTGAT[A/G,GAGTAATGTAGGTGTAAGAGTGAGTTGATGAATTATAGGGTAGATGAATTATAGGTGTAAGAGTGAGTTGA]
AATTATAGGGTAGATGAATTATAGGTGTAAGAGTGAGTTCATTTATCTAGATTTTTCTGTAATGTGACTATCTATATCAGCTAGACAGTATTTAGACAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 19.90% 0.00% 0.00% TCAACTCACTCTTACACCTATAATTCATCTACCCTATAATTCATCAACTCACTCTTACACCTACATTACTC: 0.02%
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 39.60% 60.40% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.00% TCAACTCACTCTTACACCTATAATTCATCTACCCTATAATTCATCAACTCACTCTTACACCTACATTACTC: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 38.60% 61.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311656964 T -> C LOC_Os03g20560.1 upstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20550.1 downstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20570.1 downstream_gene_variant ; 347.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20580.1 downstream_gene_variant ; 3436.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20550.3 downstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20550.2 downstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> C LOC_Os03g20570-LOC_Os03g20580 intergenic_region ; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20560.1 upstream_gene_variant ; 2997.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20550.1 downstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20570.1 downstream_gene_variant ; 348.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20580.1 downstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20550.3 downstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20550.2 downstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N
vg0311656964 T -> TCAACTCACTCTTACACCTATAATTCATCT ACCCTATAATTCATCAACTCACTCTTACAC CTACATTACTC LOC_Os03g20570-LOC_Os03g20580 intergenic_region ; MODIFIER silent_mutation Average:82.502; most accessible tissue: Zhenshan97 flower, score: 89.315 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0311656964 T C -0.09 -0.06 -0.07 -0.07 -0.07 -0.08
vg0311656964 T TCAAC* -0.36 -0.24 -0.19 -0.23 -0.23 -0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311656964 NA 2.89E-36 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311656964 NA 3.89E-53 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311656964 NA 3.72E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 7.13E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.18E-25 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 7.98E-18 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 9.71E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 5.39E-56 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.98E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 7.62E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 8.58E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 8.26E-88 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 5.38E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.53E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 7.41E-71 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.23E-61 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 6.09E-37 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 4.00E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.04E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.27E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 8.20E-78 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.32E-33 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.92E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 9.86E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 8.40E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.94E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.24E-08 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 6.49E-13 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.28E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.86E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.92E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.47E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.04E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.44E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.77E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.28E-27 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.58E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.86E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.39E-69 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.08E-14 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.25E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.10E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.23E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.56E-99 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.74E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.72E-32 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 5.99E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.26E-77 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.70E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.73E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 5.00E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 6.89E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.83E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.89E-78 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 4.24E-45 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.23E-32 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.11E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 3.83E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.31E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 4.84E-42 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 6.38E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.85E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 1.21E-38 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 9.17E-06 NA mr1870_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311656964 NA 2.70E-08 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251