Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311535858:

Variant ID: vg0311535858 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11535858
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAAAATTATGCCACAATGGACCAAAATACCCTTGTACACATCAATATTCTCTTATCCTCTCCCTCTCATCTCTCTCACCGGAGCTTGTCTCCCTCT[A/C,T]
ATCTTTCTCGCCAGAAATGGGAGGGATAGCGGCGGCGGCTCGACGAGGAGGAGGAGCGGCGACGGCTCGACAAGGCGGAGGACGGCGGCGGCATGGGAGG

Reverse complement sequence

CCTCCCATGCCGCCGCCGTCCTCCGCCTTGTCGAGCCGTCGCCGCTCCTCCTCCTCGTCGAGCCGCCGCCGCTATCCCTCCCATTTCTGGCGAGAAAGAT[T/G,A]
AGAGGGAGACAAGCTCCGGTGAGAGAGATGAGAGGGAGAGGATAAGAGAATATTGATGTGTACAAGGGTATTTTGGTCCATTGTGGCATAATTTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	19.70%	0.02%	0.00%	T: 0.19%
All Indica	2759	99.80%	0.10%	0.04%	0.00%	T: 0.04%
All Japonica	1512	39.70%	60.30%	0.00%	0.00%	NA
Aus	269	97.00%	0.00%	0.00%	0.00%	T: 2.97%
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.30%	0.13%	0.00%	T: 0.13%
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.60%	0.00%	0.00%	NA
Japonica Intermediate	241	40.20%	59.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311535858	A -> C	LOC_Os03g20380.1	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.4	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.5	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.8	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.7	upstream_gene_variant ; 4742.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.2	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.3	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380.6	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> C	LOC_Os03g20380-LOC_Os03g20390	intergenic_region ; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.1	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.4	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.5	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.8	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.7	upstream_gene_variant ; 4742.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.2	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.3	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380.6	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0311535858	A -> T	LOC_Os03g20380-LOC_Os03g20390	intergenic_region ; MODIFIER	silent_mutation	Average:49.477; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311535858	NA	1.37E-25	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.02E-16	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.41E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.89E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.73E-40	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	8.32E-06	5.28E-61	mr1241	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	7.65E-15	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.08E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	5.07E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.06E-86	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	8.79E-08	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	5.33E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.34E-37	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.37E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	7.47E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	9.11E-13	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	9.37E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.05E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.21E-72	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.73E-32	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.93E-15	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.72E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	8.79E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.70E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.38E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.29E-07	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.30E-24	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.00E-67	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.42E-12	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.92E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.71E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.48E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.38E-23	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.62E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.09E-95	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.35E-22	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.07E-35	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.21E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.31E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.52E-08	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.69E-44	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.10E-29	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.29E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.27E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.69E-16	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	3.02E-73	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.20E-29	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	5.41E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	1.91E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	2.12E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311535858	NA	4.00E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251