RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0311534838:

Variant ID: vg0311534838 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11534838
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGCACGGGATATTGCGTTTTCCCGTGCGGGCGACAGCCTGGAGCTTGTCCCCTATTTTTCCATGCGGTTACACTTACGAACCGTATGGAAATCAAAGTA[A/G]
TGATCACACGACAACTGAATTTTCGATTTCTTTTTCTATTGCTCAAAACAGTTACTAACTTTTGTTTTGCTTTTGTCAAAAGAAAAAAACTTTTGTTTTG

Reverse complement sequence

CAAAACAAAAGTTTTTTTCTTTTGACAAAAGCAAAACAAAAGTTAGTAACTGTTTTGAGCAATAGAAAAAGAAATCGAAAATTCAGTTGTCGTGTGATCA[T/C]
TACTTTGATTTCCATACGGTTCGTAAGTGTAACCGCATGGAAAAATAGGGGACAAGCTCCAGGCTGTCGCCCGCACGGGAAAACGCAATATCCCGTGCGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	18.30%	0.04%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	43.80%	56.00%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	2.30%	97.50%	0.13%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	61.00%	38.60%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311534838	A -> G	LOC_Os03g20380.1	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.4	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.5	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.8	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.7	upstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.2	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.3	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380.6	upstream_gene_variant ; 2855.0bp to feature; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N
vg0311534838	A -> G	LOC_Os03g20380-LOC_Os03g20390	intergenic_region ; MODIFIER	silent_mutation	Average:67.99; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N

Showing 1 to 9 of 9 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311534838	NA	1.22E-34	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0311534838	NA	4.28E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	4.59E-06	5.45E-61	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	1.39E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	3.07E-06	NA	mr1065	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	2.54E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	9.08E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	5.67E-07	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	3.12E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311534838	NA	1.05E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 89 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0311534838:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact