Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311427500:

Variant ID: vg0311427500 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11427500
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATTTCTTGTATGCAAAACTTGTTTATGTAGTTTTTGATGGTAGGATATATATCATTTTGGAAATATCATTTTTGCAAGATGACAATTTGGTGATATA[G/A]
TAGATATATTGTTTTCTCATTTTGACTAAATATCATGTTATAAACAAAATAAGGGTTAGAGAAATACAATGCACTAGATATATAAATGTCATATATGATT

Reverse complement sequence

AATCATATATGACATTTATATATCTAGTGCATTGTATTTCTCTAACCCTTATTTTGTTTATAACATGATATTTAGTCAAAATGAGAAAACAATATATCTA[C/T]
TATATCACCAAATTGTCATCTTGCAAAAATGATATTTCCAAAATGATATATATCCTACCATCAAAAACTACATAAACAAGTTTTGCATACAAGAAATACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.20%	37.80%	4.68%	14.37%	NA
All Indica	2759	69.30%	30.00%	0.51%	0.14%	NA
All Japonica	1512	0.80%	42.50%	12.90%	43.85%	NA
Aus	269	29.40%	70.30%	0.37%	0.00%	NA
Indica I	595	28.70%	70.40%	0.84%	0.00%	NA
Indica II	465	91.40%	8.20%	0.43%	0.00%	NA
Indica III	913	87.70%	12.00%	0.22%	0.00%	NA
Indica Intermediate	786	65.50%	33.30%	0.64%	0.51%	NA
Temperate Japonica	767	0.90%	6.90%	16.04%	76.14%	NA
Tropical Japonica	504	0.20%	95.20%	2.98%	1.59%	NA
Japonica Intermediate	241	1.70%	45.20%	23.65%	29.46%	NA
VI/Aromatic	96	5.20%	92.70%	2.08%	0.00%	NA
Intermediate	90	35.60%	41.10%	10.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311427500	G -> A	LOC_Os03g20220.1	upstream_gene_variant ; 1941.0bp to feature; MODIFIER	silent_mutation	Average:18.614; most accessible tissue: Callus, score: 37.329	N	N	N	N
vg0311427500	G -> A	LOC_Os03g20230.1	upstream_gene_variant ; 1457.0bp to feature; MODIFIER	silent_mutation	Average:18.614; most accessible tissue: Callus, score: 37.329	N	N	N	N
vg0311427500	G -> A	LOC_Os03g20210.1	downstream_gene_variant ; 3686.0bp to feature; MODIFIER	silent_mutation	Average:18.614; most accessible tissue: Callus, score: 37.329	N	N	N	N
vg0311427500	G -> A	LOC_Os03g20220-LOC_Os03g20230	intergenic_region ; MODIFIER	silent_mutation	Average:18.614; most accessible tissue: Callus, score: 37.329	N	N	N	N
vg0311427500	G -> DEL	N	N	silent_mutation	Average:18.614; most accessible tissue: Callus, score: 37.329	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311427500	1.90E-06	1.90E-06	mr1703	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311427500	NA	1.95E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251