\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311402280:

Variant ID: vg0311402280 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11402280
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAGGGTGGAAAAACTTAACTAGTGGCATATAAGGGAGAAGCCAATTTTGAGTGGCATATAAGGGAACTGGTCAAATTCTATGGCATATAAGAGATT[C/T,A]
TCTTTTTTATTCGTGTCTGAAAACCCATTTCGACATCAGGTCAAACGTCGGATGTGACACCCGAAAATTTTCTTTTCGCGAACTACACACACCCAAAAGC

Reverse complement sequence

GCTTTTGGGTGTGTGTAGTTCGCGAAAAGAAAATTTTCGGGTGTCACATCCGACGTTTGACCTGATGTCGAAATGGGTTTTCAGACACGAATAAAAAAGA[G/A,T]
AATCTCTTATATGCCATAGAATTTGACCAGTTCCCTTATATGCCACTCAAAATTGGCTTCTCCCTTATATGCCACTAGTTAAGTTTTTCCACCCTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.10% 0.38% 0.00% A: 0.06%
All Indica  2759 73.40% 26.10% 0.43% 0.00% A: 0.11%
All Japonica  1512 62.90% 36.80% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 30.90% 68.40% 0.67% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 93.20% 6.20% 0.44% 0.00% A: 0.11%
Indica Intermediate  786 71.40% 27.90% 0.51% 0.00% A: 0.25%
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 7.90% 91.70% 0.40% 0.00% NA
Japonica Intermediate  241 63.10% 36.10% 0.83% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311402280 C -> T LOC_Os03g20180.1 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> T LOC_Os03g20180.2 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> T LOC_Os03g20170.1 downstream_gene_variant ; 3285.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> T LOC_Os03g20170-LOC_Os03g20180 intergenic_region ; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> A LOC_Os03g20180.1 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> A LOC_Os03g20180.2 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> A LOC_Os03g20170.1 downstream_gene_variant ; 3285.0bp to feature; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N
vg0311402280 C -> A LOC_Os03g20170-LOC_Os03g20180 intergenic_region ; MODIFIER silent_mutation Average:92.148; most accessible tissue: Minghui63 flower, score: 94.309 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0311402280 C A 0.01 0.0 -0.01 0.0 -0.01 -0.02
vg0311402280 C T -0.02 0.0 0.0 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311402280 NA 5.17E-18 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 2.18E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 9.34E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 1.12E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 2.52E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 5.08E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 8.93E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 3.69E-08 mr1844 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 3.39E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 1.22E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 7.44E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311402280 NA 1.26E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251