\
| Variant ID: vg0311304375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 11304375 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
CCACTTCGCCATCGATGCAGGTACTAGCCAAGCATCTGAACGCTCCGGCCGCAGCATGAAATTCACACAGCCGAAAACGGTTTTCCTCGGACCCGCCGGC[G/A]
TCTGCACGTCTTTGGTCGAGGCGCATGCAGTAAACAGAGCGGCAAATAGCTCAGCGGTAGGGACGAACCCACAGGTTCGGCACATCCAAGCGAAAACCGC
GCGGTTTTCGCTTGGATGTGCCGAACCTGTGGGTTCGTCCCTACCGCTGAGCTATTTGCCGCTCTGTTTACTGCATGCGCCTCGACCAAAGACGTGCAGA[C/T]
GCCGGCGGGTCCGAGGAAAACCGTTTTCGGCTGTGTGAATTTCATGCTGCGGCCGGAGCGTTCAGATGCTTGGCTAGTACCTGCATCGATGGCGAAGTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 15.30% | 2.64% | 21.98% | NA |
| All Indica | 2759 | 35.40% | 25.50% | 3.91% | 35.19% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.13% | 0.26% | NA |
| Aus | 269 | 72.50% | 4.50% | 4.09% | 18.96% | NA |
| Indica I | 595 | 51.40% | 10.60% | 0.84% | 37.14% | NA |
| Indica II | 465 | 4.30% | 61.10% | 4.09% | 30.54% | NA |
| Indica III | 913 | 38.70% | 16.10% | 5.15% | 40.09% | NA |
| Indica Intermediate | 786 | 37.90% | 26.60% | 4.71% | 30.79% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 8.90% | 4.44% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0311304375 | G -> A | LOC_Os03g20070.1 | upstream_gene_variant ; 3235.0bp to feature; MODIFIER | silent_mutation | Average:48.141; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0311304375 | G -> A | LOC_Os03g20050.1 | downstream_gene_variant ; 3621.0bp to feature; MODIFIER | silent_mutation | Average:48.141; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0311304375 | G -> A | LOC_Os03g20060.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.141; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0311304375 | G -> DEL | N | N | silent_mutation | Average:48.141; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0311304375 | NA | 3.15E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.51E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 2.68E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 6.19E-07 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 4.50E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.20E-11 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.18E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.74E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 5.82E-06 | mr1731 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.80E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 6.68E-07 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.18E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 3.19E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.55E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.28E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 1.47E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | 9.07E-07 | NA | mr1581_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311304375 | NA | 2.21E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |