\
| Variant ID: vg0311297778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 11297778 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )
AATCAACAGAGCAGTGCATAATGTTGAGGCCGAACCACATGACCGGGCGAAGCACGCGCTAAAGTCCGCCCCTCACGGCAAGATAATCAAGATGCAGATT[G/A]
ATGACGCCGACCCCACAAAGCTCGTATCGCTGGGGGGCGACATGGGCGAAGAAGAGGCTGCGAACATTCTAGAGGTACTCAAGAAAAATAGTGATATCTT
AAGATATCACTATTTTTCTTGAGTACCTCTAGAATGTTCGCAGCCTCTTCTTCGCCCATGTCGCCCCCCAGCGATACGAGCTTTGTGGGGTCGGCGTCAT[C/T]
AATCTGCATCTTGATTATCTTGCCGTGAGGGGCGGACTTTAGCGCGTGCTTCGCCCGGTCATGTGGTTCGGCCTCAACATTATGCACTGCTCTGTTGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 7.40% | 3.07% | 1.80% | NA |
| All Indica | 2759 | 79.90% | 11.90% | 5.11% | 3.08% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.20% | 5.20% | 5.38% | 1.18% | NA |
| Indica II | 465 | 27.10% | 46.20% | 14.41% | 12.26% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 82.20% | 10.10% | 5.09% | 2.67% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 14.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0311297778 | G -> A | LOC_Os03g20050.1 | missense_variant ; p.Asp140Asn; MODERATE | nonsynonymous_codon ; D140N | Average:52.797; most accessible tissue: Minghui63 flag leaf, score: 71.116 | possibly damaging |
1.641 |
DELETERIOUS | 0.03 |
| vg0311297778 | G -> DEL | LOC_Os03g20050.1 | N | frameshift_variant | Average:52.797; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0311297778 | NA | 3.78E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 4.72E-06 | mr1040_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | 4.81E-06 | NA | mr1301_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 1.21E-07 | mr1362_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 5.34E-06 | mr1406_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | 7.16E-06 | 7.16E-06 | mr1424_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 6.78E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 8.99E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 7.49E-06 | mr1787_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | NA | 3.58E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | 1.70E-06 | NA | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | 5.55E-07 | NA | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311297778 | 3.12E-06 | 2.19E-07 | mr1938_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |