\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311292417:

Variant ID: vg0311292417 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11292417
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GGATTAATTGCGGTTTATTTGTTCTATCTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTCATACATCCGAAAGCGAGCTTTGGACCTGCACTGGA[G/A]
TTAAGCAGATCTCCCAGGCCTCGTGTTTTCTGTCAACACCTTCCCAACGGCCACATTTTGGGGGATCTATAAATACCCCCACCTAACTCTTTTCTAGGGT

Reverse complement sequence

ACCCTAGAAAAGAGTTAGGTGGGGGTATTTATAGATCCCCCAAAATGTGGCCGTTGGGAAGGTGTTGACAGAAAACACGAGGCCTGGGAGATCTGCTTAA[C/T]
TCCAGTGCAGGTCCAAAGCTCGCTTTCGGATGTATGAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAGATAGAACAAATAAACCGCAATTAATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.10% 0.13% 0.42% NA
All Indica  2759 30.00% 69.30% 0.14% 0.58% NA
All Japonica  1512 99.10% 0.60% 0.13% 0.13% NA
Aus  269 70.60% 29.40% 0.00% 0.00% NA
Indica I  595 70.40% 28.20% 0.17% 1.18% NA
Indica II  465 3.40% 96.60% 0.00% 0.00% NA
Indica III  913 12.90% 86.40% 0.11% 0.55% NA
Indica Intermediate  786 34.90% 64.40% 0.25% 0.51% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.20% 0.20% NA
Japonica Intermediate  241 97.50% 1.70% 0.41% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 63.30% 35.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311292417 G -> A LOC_Os03g20020.1 upstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0311292417 G -> A LOC_Os03g20040.1 upstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0311292417 G -> A LOC_Os03g20050.1 upstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0311292417 G -> A LOC_Os03g20020-LOC_Os03g20040 intergenic_region ; MODIFIER silent_mutation Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0311292417 G -> DEL N N silent_mutation Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311292417 NA 2.16E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 7.54E-08 mr1137_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 1.34E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 2.63E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 1.42E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 2.39E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 3.34E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 1.42E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 1.05E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 2.33E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 3.69E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311292417 NA 6.02E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251