\
| Variant ID: vg0311292417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 11292417 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 241. )
GGATTAATTGCGGTTTATTTGTTCTATCTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTCATACATCCGAAAGCGAGCTTTGGACCTGCACTGGA[G/A]
TTAAGCAGATCTCCCAGGCCTCGTGTTTTCTGTCAACACCTTCCCAACGGCCACATTTTGGGGGATCTATAAATACCCCCACCTAACTCTTTTCTAGGGT
ACCCTAGAAAAGAGTTAGGTGGGGGTATTTATAGATCCCCCAAAATGTGGCCGTTGGGAAGGTGTTGACAGAAAACACGAGGCCTGGGAGATCTGCTTAA[C/T]
TCCAGTGCAGGTCCAAAGCTCGCTTTCGGATGTATGAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAGATAGAACAAATAAACCGCAATTAATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 43.10% | 0.13% | 0.42% | NA |
| All Indica | 2759 | 30.00% | 69.30% | 0.14% | 0.58% | NA |
| All Japonica | 1512 | 99.10% | 0.60% | 0.13% | 0.13% | NA |
| Aus | 269 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.40% | 28.20% | 0.17% | 1.18% | NA |
| Indica II | 465 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 12.90% | 86.40% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 34.90% | 64.40% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0311292417 | G -> A | LOC_Os03g20020.1 | upstream_gene_variant ; 4521.0bp to feature; MODIFIER | silent_mutation | Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0311292417 | G -> A | LOC_Os03g20040.1 | upstream_gene_variant ; 2506.0bp to feature; MODIFIER | silent_mutation | Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0311292417 | G -> A | LOC_Os03g20050.1 | upstream_gene_variant ; 4944.0bp to feature; MODIFIER | silent_mutation | Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0311292417 | G -> A | LOC_Os03g20020-LOC_Os03g20040 | intergenic_region ; MODIFIER | silent_mutation | Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0311292417 | G -> DEL | N | N | silent_mutation | Average:29.523; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0311292417 | NA | 2.16E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 7.54E-08 | mr1137_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 1.34E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 2.63E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 1.42E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 2.39E-08 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 3.34E-06 | mr1406_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 1.42E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 1.05E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 2.33E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 3.69E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311292417 | NA | 6.02E-08 | mr1949_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |