RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0311067844:

Variant ID: vg0311067844 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 11067844
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAATGAGAAAAACAGGTGCGCCATGTATTAATTGTAAAGAGCTAACTATTATATAGGTAGGCTGAGAGAAAGCTACAAAGAACCTTATAGCCAACAGGT[C/T]
GGCTGTATTATTAGCCTTGCTCCGAGGATGCGTTCGTTACCTCCCGTTCCCAACTTCCCTCCCTCGTATTTCGCGCGCACGCTTTTCAAACTGCTAAACG

Reverse complement sequence

CGTTTAGCAGTTTGAAAAGCGTGCGCGCGAAATACGAGGGAGGGAAGTTGGGAACGGGAGGTAACGAACGCATCCTCGGAGCAAGGCTAATAATACAGCC[G/A]
ACCTGTTGGCTATAAGGTTCTTTGTAGCTTTCTCTCAGCCTACCTATATAATAGTTAGCTCTTTACAATTAATACATGGCGCACCTGTTTTTCTCATTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	1.70%	0.93%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	91.90%	5.20%	2.84%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	84.90%	10.00%	5.08%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.80%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0311067844	C -> T	LOC_Os03g19680.1	upstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0311067844	C -> T	LOC_Os03g19690.1	upstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0311067844	C -> T	LOC_Os03g19690.2	upstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0311067844	C -> T	LOC_Os03g19670-LOC_Os03g19680	intergenic_region ; MODIFIER	silent_mutation	Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0311067844	NA	4.14E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	2.85E-06	1.09E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	NA	8.46E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	NA	3.67E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	2.29E-06	2.29E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	4.54E-07	2.30E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	NA	5.70E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844	1.62E-08	5.04E-11	mr1585_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0311067844:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact