\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311067844:

Variant ID: vg0311067844 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11067844
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATGAGAAAAACAGGTGCGCCATGTATTAATTGTAAAGAGCTAACTATTATATAGGTAGGCTGAGAGAAAGCTACAAAGAACCTTATAGCCAACAGGT[C/T]
GGCTGTATTATTAGCCTTGCTCCGAGGATGCGTTCGTTACCTCCCGTTCCCAACTTCCCTCCCTCGTATTTCGCGCGCACGCTTTTCAAACTGCTAAACG

Reverse complement sequence

CGTTTAGCAGTTTGAAAAGCGTGCGCGCGAAATACGAGGGAGGGAAGTTGGGAACGGGAGGTAACGAACGCATCCTCGGAGCAAGGCTAATAATACAGCC[G/A]
ACCTGTTGGCTATAAGGTTCTTTGTAGCTTTCTCTCAGCCTACCTATATAATAGTTAGCTCTTTACAATTAATACATGGCGCACCTGTTTTTCTCATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.70% 0.93% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 91.90% 5.20% 2.84% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 84.90% 10.00% 5.08% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.80% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311067844 C -> T LOC_Os03g19680.1 upstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0311067844 C -> T LOC_Os03g19690.1 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0311067844 C -> T LOC_Os03g19690.2 upstream_gene_variant ; 4150.0bp to feature; MODIFIER silent_mutation Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0311067844 C -> T LOC_Os03g19670-LOC_Os03g19680 intergenic_region ; MODIFIER silent_mutation Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311067844 NA 4.14E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 2.85E-06 1.09E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 NA 8.46E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 NA 3.67E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 2.29E-06 2.29E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 4.54E-07 2.30E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 NA 5.70E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311067844 1.62E-08 5.04E-11 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251