\
| Variant ID: vg0311067844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 11067844 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAATGAGAAAAACAGGTGCGCCATGTATTAATTGTAAAGAGCTAACTATTATATAGGTAGGCTGAGAGAAAGCTACAAAGAACCTTATAGCCAACAGGT[C/T]
GGCTGTATTATTAGCCTTGCTCCGAGGATGCGTTCGTTACCTCCCGTTCCCAACTTCCCTCCCTCGTATTTCGCGCGCACGCTTTTCAAACTGCTAAACG
CGTTTAGCAGTTTGAAAAGCGTGCGCGCGAAATACGAGGGAGGGAAGTTGGGAACGGGAGGTAACGAACGCATCCTCGGAGCAAGGCTAATAATACAGCC[G/A]
ACCTGTTGGCTATAAGGTTCTTTGTAGCTTTCTCTCAGCCTACCTATATAATAGTTAGCTCTTTACAATTAATACATGGCGCACCTGTTTTTCTCATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 1.70% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.90% | 5.20% | 2.84% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.90% | 10.00% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.80% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0311067844 | C -> T | LOC_Os03g19680.1 | upstream_gene_variant ; 1098.0bp to feature; MODIFIER | silent_mutation | Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
| vg0311067844 | C -> T | LOC_Os03g19690.1 | upstream_gene_variant ; 4050.0bp to feature; MODIFIER | silent_mutation | Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
| vg0311067844 | C -> T | LOC_Os03g19690.2 | upstream_gene_variant ; 4150.0bp to feature; MODIFIER | silent_mutation | Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
| vg0311067844 | C -> T | LOC_Os03g19670-LOC_Os03g19680 | intergenic_region ; MODIFIER | silent_mutation | Average:66.394; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0311067844 | NA | 4.14E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | 2.85E-06 | 1.09E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | NA | 8.46E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | NA | 3.67E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | 2.29E-06 | 2.29E-06 | mr1649 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | 4.54E-07 | 2.30E-08 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | NA | 5.70E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311067844 | 1.62E-08 | 5.04E-11 | mr1585_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |