\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311016054:

Variant ID: vg0311016054 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11016054
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTGCGGGGTTTGCCGCGCCGAAGGACGGGGGGATGCGGTCGCGATCCGCCCCGGTGGCTATCGTCCTGCGCTGCGTGCCTGCGCCCCGCCGGGCTCAT[G/A]
AGGCTTTCCCGAAAGCCTAAAGCGCCTATTCCCACCCACAACTGCACGCACGTTTTCTCCGGTTTTAATGAAGTTCGTAAGTGGGCTCGCGAGAATAGAG

Reverse complement sequence

CTCTATTCTCGCGAGCCCACTTACGAACTTCATTAAAACCGGAGAAAACGTGCGTGCAGTTGTGGGTGGGAATAGGCGCTTTAGGCTTTCGGGAAAGCCT[C/T]
ATGAGCCCGGCGGGGCGCAGGCACGCAGCGCAGGACGATAGCCACCGGGGCGGATCGCGACCGCATCCCCCCGTCCTTCGGCGCGGCAAACCCCGCAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 10.40% 1.99% 0.00% NA
All Indica  2759 98.00% 0.70% 1.27% 0.00% NA
All Japonica  1512 66.70% 29.90% 3.44% 0.00% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 96.10% 0.50% 3.36% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.90% 0.90% 0.22% 0.00% NA
Indica Intermediate  786 97.60% 0.80% 1.65% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 12.70% 78.60% 8.73% 0.00% NA
Japonica Intermediate  241 74.70% 22.00% 3.32% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311016054 G -> A LOC_Os03g19580.1 upstream_gene_variant ; 4167.0bp to feature; MODIFIER silent_mutation Average:83.056; most accessible tissue: Callus, score: 94.65 N N N N
vg0311016054 G -> A LOC_Os03g19590.1 upstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:83.056; most accessible tissue: Callus, score: 94.65 N N N N
vg0311016054 G -> A LOC_Os03g19580.2 upstream_gene_variant ; 4167.0bp to feature; MODIFIER silent_mutation Average:83.056; most accessible tissue: Callus, score: 94.65 N N N N
vg0311016054 G -> A LOC_Os03g19580-LOC_Os03g19590 intergenic_region ; MODIFIER silent_mutation Average:83.056; most accessible tissue: Callus, score: 94.65 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0311016054 G A 0.05 0.04 0.0 0.06 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311016054 NA 7.61E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 5.95E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 3.77E-06 NA mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 1.90E-06 1.90E-06 mr1347 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 3.20E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 4.30E-07 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 8.38E-07 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 2.08E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 7.63E-07 NA mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.00E-08 mr1401 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 8.69E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.93E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 4.13E-06 NA mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 3.45E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 2.81E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 6.92E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.23E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 4.36E-06 7.67E-20 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.01E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 5.92E-06 7.32E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 8.76E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.57E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.74E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 7.51E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 1.04E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0311016054 NA 3.87E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251