Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0311006870:

Variant ID: vg0311006870 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 11006870
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAAAAGAAAATAACAAATATATATTTGCTTACACAACATTTTTATCAAAATTACAGTACACTTACATGTTATATCAATTGAATTTATGTTATATCAA[T/A]
TGAATTTACGAATGTATTTACAAATGTATTTTAAGTTATAGGACTGTAATTTTATATTTTAAATAAATTAACTAATACATATTTACTTACACAATATTTT

Reverse complement sequence

AAAATATTGTGTAAGTAAATATGTATTAGTTAATTTATTTAAAATATAAAATTACAGTCCTATAACTTAAAATACATTTGTAAATACATTCGTAAATTCA[A/T]
TTGATATAACATAAATTCAATTGATATAACATGTAAGTGTACTGTAATTTTGATAAAAATGTTGTGTAAGCAAATATATATTTGTTATTTTCTTTTGTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.40% 0.10% 0.04% 0.44% NA
All Indica  2759 99.10% 0.20% 0.00% 0.72% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.80% 0.00% 0.00% 3.23% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.30% 0.00% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0311006870 T -> A LOC_Os03g19570.1 upstream_gene_variant ; 490.0bp to feature; MODIFIER N Average:70.678; most accessible tissue: Minghui63 root, score: 81.681 N N N N
vg0311006870 T -> A LOC_Os03g19580.1 downstream_gene_variant ; 643.0bp to feature; MODIFIER N Average:70.678; most accessible tissue: Minghui63 root, score: 81.681 N N N N
vg0311006870 T -> A LOC_Os03g19580.2 downstream_gene_variant ; 1811.0bp to feature; MODIFIER N Average:70.678; most accessible tissue: Minghui63 root, score: 81.681 N N N N
vg0311006870 T -> A LOC_Os03g19570-LOC_Os03g19580 intergenic_region ; MODIFIER N Average:70.678; most accessible tissue: Minghui63 root, score: 81.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0311006870 8.92E-06 NA mr1502_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251