\
| Variant ID: vg0310902932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 10902932 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCAGTTTGATAAAAGTATAGAGCAGGAAATAGAGGATTTTTTCGCAAGTAAAAATCTGGATACAATAGCGCAGAGCCCATACATAGGGCTTATTCGCG[C/T]
TGTAGAGCTTTTAGAGAAAGAGGGAGATGGACCTGCCCCAGCCAATGGGAATGACGCAGGGAGCCCAAGCCCAGTGGGGAGTGAAAGGCTCTCCTCGTCG
CGACGAGGAGAGCCTTTCACTCCCCACTGGGCTTGGGCTCCCTGCGTCATTCCCATTGGCTGGGGCAGGTCCATCTCCCTCTTTCTCTAAAAGCTCTACA[G/A]
CGCGAATAAGCCCTATGTATGGGCTCTGCGCTATTGTATCCAGATTTTTACTTGCGAAAAAATCCTCTATTTCCTGCTCTATACTTTTATCAAACTGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0310902932 | C -> T | LOC_Os03g19350.1 | upstream_gene_variant ; 3943.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Callus, score: 49.365 | N | N | N | N |
| vg0310902932 | C -> T | LOC_Os03g19370.1 | upstream_gene_variant ; 2670.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Callus, score: 49.365 | N | N | N | N |
| vg0310902932 | C -> T | LOC_Os03g19375.1 | upstream_gene_variant ; 3358.0bp to feature; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Callus, score: 49.365 | N | N | N | N |
| vg0310902932 | C -> T | LOC_Os03g19350-LOC_Os03g19370 | intergenic_region ; MODIFIER | silent_mutation | Average:23.301; most accessible tissue: Callus, score: 49.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0310902932 | NA | 6.63E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 5.73E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 6.05E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 5.90E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.49E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 6.95E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 2.25E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 4.52E-13 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.49E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 2.85E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 3.42E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 7.91E-08 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.55E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 4.48E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 8.35E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 6.32E-11 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 3.44E-15 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 3.82E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 2.13E-16 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 5.65E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 8.41E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.73E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 2.67E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 6.79E-10 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | 5.40E-06 | 1.79E-15 | mr1851_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.15E-17 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 1.24E-10 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 5.12E-09 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310902932 | NA | 3.05E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |