Variant ID: vg0310704341 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 10704341 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )
GCTTGATGATAATCAACTTTTTGTTCAGATTTGTGTGGATGATATAATCTTTGGTTGTTCGACTCACGCTTTGGTTGTAGATTTTGCTGAGACTATGCGC[A/T]
AGGAATTTGAGATGAGCATGATGGGTGAGTTATCGTACTTTTTGGGATTGCAAATTAAGCAAACACCTCAAGGTACTTTTGTGCATCAAACGAAGTATAC
GTATACTTCGTTTGATGCACAAAAGTACCTTGAGGTGTTTGCTTAATTTGCAATCCCAAAAAGTACGATAACTCACCCATCATGCTCATCTCAAATTCCT[T/A]
GCGCATAGTCTCAGCAAAATCTACAACCAAAGCGTGAGTCGAACAACCAAAGATTATATCATCCACACAAATCTGAACAAAAAGTTGATTATCATCAAGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.10% | 2.00% | 0.85% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 91.30% | 6.20% | 2.58% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 83.80% | 11.60% | 4.56% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 96.70% | 1.70% | 1.66% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0310704341 | A -> T | LOC_Os03g19104.1 | stop_gained ; p.Lys903*; HIGH | stop_gained | Average:15.211; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0310704341 | NA | 1.41E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | 5.93E-06 | 4.11E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | 3.13E-06 | 3.13E-06 | mr1389 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | NA | 6.53E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | NA | 1.92E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | NA | 2.74E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | 4.34E-07 | 4.34E-07 | mr1899 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | NA | 2.99E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | NA | 7.59E-06 | mr1946 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0310704341 | 2.02E-08 | 2.81E-10 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/