Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310649505:

Variant ID: vg0310649505 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10649505
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACTAAATTAGTTTAACTCAACATGCAACTATGCATAGTTGGTAACCACCTGCATCTTTTACTAGTATAAAACGTACCAAACTATCTAATTGGCATGTATT[C/T]
ATAGATTCCCTGAGTTACATAGTGAACACATCAGGATTGGTGAGAGTGTTGCAACTCTTATGTGGAATATACTATAATAAGGGCACCGATTGTCTGGTAT

Reverse complement sequence

ATACCAGACAATCGGTGCCCTTATTATAGTATATTCCACATAAGAGTTGCAACACTCTCACCAATCCTGATGTGTTCACTATGTAACTCAGGGAATCTAT[G/A]
AATACATGCCAATTAGATAGTTTGGTACGTTTTATACTAGTAAAAGATGCAGGTGGTTACCAACTATGCATAGTTGCATGTTGAGTTAAACTAATTTAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 22.90% 0.08% 0.00% NA
All Indica  2759 99.60% 0.40% 0.07% 0.00% NA
All Japonica  1512 36.00% 64.00% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.10% 0.13% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 26.10% 73.90% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310649505 C -> T LOC_Os03g19020.1 upstream_gene_variant ; 1687.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g19020.2 upstream_gene_variant ; 1687.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g19020.3 upstream_gene_variant ; 1687.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g18990.1 downstream_gene_variant ; 4228.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g19000.1 downstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g19010.1 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N
vg0310649505 C -> T LOC_Os03g19010-LOC_Os03g19020 intergenic_region ; MODIFIER silent_mutation Average:77.181; most accessible tissue: Minghui63 flower, score: 89.749 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310649505 C T 0.08 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310649505 NA 7.88E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.52E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 8.34E-54 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.97E-13 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.45E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.09E-19 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.66E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.74E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.23E-13 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.57E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.44E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.08E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.40E-17 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.57E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.89E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.99E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.07E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.57E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.82E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 7.94E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.49E-09 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.30E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.30E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.84E-23 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.89E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.17E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.06E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.03E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.51E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.24E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 6.58E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.94E-14 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.69E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 8.83E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.20E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.84E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 6.62E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.22E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.01E-63 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.74E-24 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.99E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.43E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.73E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.85E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 6.08E-07 3.47E-10 mr1350_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.08E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 8.42E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.10E-34 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.07E-12 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 6.57E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.68E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.09E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 4.73E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.35E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 3.02E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.69E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.00E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.87E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.07E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.38E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.07E-17 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 5.95E-15 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.08E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.85E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 1.80E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.52E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310649505 NA 2.83E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251