\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310570687:

Variant ID: vg0310570687 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 10570687
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTCCTCCGTTTCACAATATCATTCTAACATTATATATATATATATATATATTGATGTTAATAAATTTTAGATATAACATCAATATAAATGTGAAAAAT[A/G,ATG]
TTAGAATTACTTATATTGTGATACGGACAGAGTAGTAACAAAGGTGAACGTCTGATTACGGCTTCCCTGCCGCATTACCAAAATGGAAGAGAGTGGCGCC

Reverse complement sequence

GGCGCCACTCTCTTCCATTTTGGTAATGCGGCAGGGAAGCCGTAATCAGACGTTCACCTTTGTTACTACTCTGTCCGTATCACAATATAAGTAATTCTAA[T/C,CAT]
ATTTTTCACATTTATATTGATGTTATATCTAAAATTTATTAACATCAATATATATATATATATATATAATGTTAGAATGATATTGTGAAACGGAGGAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 32.00% 16.10% 8.17% ATG: 0.04%
All Indica  2759 36.00% 32.70% 22.25% 8.99% ATG: 0.04%
All Japonica  1512 64.00% 32.20% 0.40% 3.37% NA
Aus  269 0.70% 26.80% 43.87% 28.62% NA
Indica I  595 60.30% 10.90% 26.22% 2.52% NA
Indica II  465 69.20% 15.50% 12.90% 2.37% NA
Indica III  913 3.30% 56.50% 22.34% 17.85% NA
Indica Intermediate  786 35.90% 31.80% 24.68% 7.51% ATG: 0.13%
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 6.30% 83.30% 0.60% 9.72% NA
Japonica Intermediate  241 72.60% 25.70% 0.83% 0.83% NA
VI/Aromatic  96 68.80% 17.70% 10.42% 3.12% NA
Intermediate  90 38.90% 37.80% 14.44% 7.78% ATG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310570687 A -> ATG LOC_Os03g18860.1 upstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> ATG LOC_Os03g18870.1 downstream_gene_variant ; 951.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> ATG LOC_Os03g18880.1 downstream_gene_variant ; 4710.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> ATG LOC_Os03g18860-LOC_Os03g18870 intergenic_region ; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> DEL N N silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> G LOC_Os03g18860.1 upstream_gene_variant ; 3881.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> G LOC_Os03g18870.1 downstream_gene_variant ; 952.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> G LOC_Os03g18880.1 downstream_gene_variant ; 4711.0bp to feature; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N
vg0310570687 A -> G LOC_Os03g18860-LOC_Os03g18870 intergenic_region ; MODIFIER silent_mutation Average:88.236; most accessible tissue: Callus, score: 96.519 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310570687 A ATG -0.01 -0.16 -0.23 -0.13 -0.09 -0.11
vg0310570687 A G -0.01 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310570687 NA 1.42E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 5.15E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 8.66E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.12E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 4.31E-06 NA mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.89E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.04E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 8.52E-13 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 7.34E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.52E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.03E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 7.71E-08 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.47E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.62E-09 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.87E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.13E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.37E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.58E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 8.34E-20 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.63E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.82E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.18E-12 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 9.74E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 9.65E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.40E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.63E-16 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.44E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 8.16E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 5.02E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 9.42E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.65E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.32E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.11E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.58E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.76E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.15E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.16E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.39E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.97E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 6.96E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.25E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.55E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.08E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 5.65E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.83E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.07E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 4.79E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.54E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 1.13E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 2.22E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 8.01E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 3.74E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310570687 NA 5.46E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251