\
| Variant ID: vg0310513409 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 10513409 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAAAACGGAGGTAAAAGGAGTAGTAAGTACTCAATGCTTGCATATGCAACAACATTTTTCTGCCTGCTAATAGTCTAATGAGCCTCACTCCGGTGCTTT[C/T]
TACTTGTAGTAGAAAATAATCCGAGCCGTTGATCGTATATAATCGTCAGGTTGAGATCTAGTTCTACTACCACCACGCTTAGTGGTAGTAGAAACATGGA
TCCATGTTTCTACTACCACTAAGCGTGGTGGTAGTAGAACTAGATCTCAACCTGACGATTATATACGATCAACGGCTCGGATTATTTTCTACTACAAGTA[G/A]
AAAGCACCGGAGTGAGGCTCATTAGACTATTAGCAGGCAGAAAAATGTTGTTGCATATGCAAGCATTGAGTACTTACTACTCCTTTTACCTCCGTTTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.50% | 17.90% | 27.08% | 29.56% | NA |
| All Indica | 2759 | 1.10% | 29.00% | 43.39% | 26.53% | NA |
| All Japonica | 1512 | 71.30% | 1.50% | 0.73% | 26.52% | NA |
| Aus | 269 | 1.50% | 2.60% | 14.13% | 81.78% | NA |
| Indica I | 595 | 0.80% | 20.30% | 60.50% | 18.32% | NA |
| Indica II | 465 | 0.40% | 24.50% | 45.81% | 29.25% | NA |
| Indica III | 913 | 1.60% | 38.00% | 29.24% | 31.11% | NA |
| Indica Intermediate | 786 | 1.00% | 27.70% | 45.42% | 25.83% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.52% | 0.65% | NA |
| Tropical Japonica | 504 | 26.60% | 4.00% | 0.40% | 69.05% | NA |
| Japonica Intermediate | 241 | 77.20% | 0.80% | 2.07% | 19.92% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 12.50% | 20.83% | NA |
| Intermediate | 90 | 31.10% | 17.80% | 24.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0310513409 | C -> T | LOC_Os03g18750.1 | upstream_gene_variant ; 2198.0bp to feature; MODIFIER | silent_mutation | Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0310513409 | C -> T | LOC_Os03g18760.1 | downstream_gene_variant ; 167.0bp to feature; MODIFIER | silent_mutation | Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0310513409 | C -> T | LOC_Os03g18770.1 | downstream_gene_variant ; 3699.0bp to feature; MODIFIER | silent_mutation | Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0310513409 | C -> T | LOC_Os03g18750-LOC_Os03g18760 | intergenic_region ; MODIFIER | silent_mutation | Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0310513409 | C -> DEL | N | N | silent_mutation | Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0310513409 | NA | 1.71E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | NA | 9.91E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | NA | 5.91E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | NA | 2.13E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | NA | 7.66E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | 8.89E-09 | 1.47E-07 | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310513409 | NA | 3.75E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |