\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310513409:

Variant ID: vg0310513409 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10513409
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAACGGAGGTAAAAGGAGTAGTAAGTACTCAATGCTTGCATATGCAACAACATTTTTCTGCCTGCTAATAGTCTAATGAGCCTCACTCCGGTGCTTT[C/T]
TACTTGTAGTAGAAAATAATCCGAGCCGTTGATCGTATATAATCGTCAGGTTGAGATCTAGTTCTACTACCACCACGCTTAGTGGTAGTAGAAACATGGA

Reverse complement sequence

TCCATGTTTCTACTACCACTAAGCGTGGTGGTAGTAGAACTAGATCTCAACCTGACGATTATATACGATCAACGGCTCGGATTATTTTCTACTACAAGTA[G/A]
AAAGCACCGGAGTGAGGCTCATTAGACTATTAGCAGGCAGAAAAATGTTGTTGCATATGCAAGCATTGAGTACTTACTACTCCTTTTACCTCCGTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 17.90% 27.08% 29.56% NA
All Indica  2759 1.10% 29.00% 43.39% 26.53% NA
All Japonica  1512 71.30% 1.50% 0.73% 26.52% NA
Aus  269 1.50% 2.60% 14.13% 81.78% NA
Indica I  595 0.80% 20.30% 60.50% 18.32% NA
Indica II  465 0.40% 24.50% 45.81% 29.25% NA
Indica III  913 1.60% 38.00% 29.24% 31.11% NA
Indica Intermediate  786 1.00% 27.70% 45.42% 25.83% NA
Temperate Japonica  767 98.80% 0.00% 0.52% 0.65% NA
Tropical Japonica  504 26.60% 4.00% 0.40% 69.05% NA
Japonica Intermediate  241 77.20% 0.80% 2.07% 19.92% NA
VI/Aromatic  96 66.70% 0.00% 12.50% 20.83% NA
Intermediate  90 31.10% 17.80% 24.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310513409 C -> T LOC_Os03g18750.1 upstream_gene_variant ; 2198.0bp to feature; MODIFIER silent_mutation Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0310513409 C -> T LOC_Os03g18760.1 downstream_gene_variant ; 167.0bp to feature; MODIFIER silent_mutation Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0310513409 C -> T LOC_Os03g18770.1 downstream_gene_variant ; 3699.0bp to feature; MODIFIER silent_mutation Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0310513409 C -> T LOC_Os03g18750-LOC_Os03g18760 intergenic_region ; MODIFIER silent_mutation Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0310513409 C -> DEL N N silent_mutation Average:41.26; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310513409 NA 1.71E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 NA 9.91E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 NA 5.91E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 NA 2.13E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 NA 7.66E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 8.89E-09 1.47E-07 mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310513409 NA 3.75E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251