\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310513352:

Variant ID: vg0310513352 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10513352
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTTAGATTCGTTAACGTCAATTTAAATATGAGAAATGTTAGAATGACTTACATTATAAAACGGAGGTAAAAGGAGTAGTAAGTACTCAATGCTTGCA[T/A]
ATGCAACAACATTTTTCTGCCTGCTAATAGTCTAATGAGCCTCACTCCGGTGCTTTCTACTTGTAGTAGAAAATAATCCGAGCCGTTGATCGTATATAAT

Reverse complement sequence

ATTATATACGATCAACGGCTCGGATTATTTTCTACTACAAGTAGAAAGCACCGGAGTGAGGCTCATTAGACTATTAGCAGGCAGAAAAATGTTGTTGCAT[A/T]
TGCAAGCATTGAGTACTTACTACTCCTTTTACCTCCGTTTTATAATGTAAGTCATTCTAACATTTCTCATATTTAAATTGACGTTAACGAATCTAAACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 2.70% 2.22% 0.28% NA
All Indica  2759 99.10% 0.00% 0.40% 0.47% NA
All Japonica  1512 85.60% 8.20% 6.15% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 96.60% 0.00% 0.86% 2.58% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 76.50% 13.40% 10.04% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 86.30% 7.90% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310513352 T -> A LOC_Os03g18750.1 upstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0310513352 T -> A LOC_Os03g18760.1 downstream_gene_variant ; 224.0bp to feature; MODIFIER silent_mutation Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0310513352 T -> A LOC_Os03g18770.1 downstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0310513352 T -> A LOC_Os03g18750-LOC_Os03g18760 intergenic_region ; MODIFIER silent_mutation Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0310513352 T -> DEL N N silent_mutation Average:45.928; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310513352 6.77E-07 6.77E-07 mr1011 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251