\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310381006:

Variant ID: vg0310381006 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10381006
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GACCCTAAAAAAATAAAAATGGGTTAGTCAATTTGGCTCCATTACTATCCTCTCTTCTACCTATTACCATTAACTTCTACTACTAAATTAGTCTATTATT[A/G]
AAAAATGCTACTCCCTCCGCCTTAAAATATAGCACCTAGATGGATGAAATACAAGTATTACGAATCTGAAATATAAGTATTAATGGATGAAATACAAGTA

Reverse complement sequence

TACTTGTATTTCATCCATTAATACTTATATTTCAGATTCGTAATACTTGTATTTCATCCATCTAGGTGCTATATTTTAAGGCGGAGGGAGTAGCATTTTT[T/C]
AATAATAGACTAATTTAGTAGTAGAAGTTAATGGTAATAGGTAGAAGAGAGGATAGTAATGGAGCCAAATTGACTAACCCATTTTTATTTTTTTAGGGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.20% 3.90% 4.06% 69.89% NA
All Indica  2759 0.50% 4.60% 4.71% 90.14% NA
All Japonica  1512 66.90% 2.10% 2.12% 28.90% NA
Aus  269 0.00% 4.10% 7.06% 88.85% NA
Indica I  595 0.70% 2.70% 2.35% 94.29% NA
Indica II  465 0.20% 1.90% 5.81% 92.04% NA
Indica III  913 0.50% 6.60% 5.81% 87.08% NA
Indica Intermediate  786 0.60% 5.30% 4.58% 89.44% NA
Temperate Japonica  767 98.70% 0.00% 0.13% 1.17% NA
Tropical Japonica  504 18.70% 5.80% 5.56% 70.04% NA
Japonica Intermediate  241 66.40% 1.20% 1.24% 31.12% NA
VI/Aromatic  96 3.10% 6.20% 7.29% 83.33% NA
Intermediate  90 20.00% 8.90% 4.44% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310381006 A -> DEL N N silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18540.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18540.2 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18540.4 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18510.1 downstream_gene_variant ; 4964.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18520.1 downstream_gene_variant ; 1472.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18530.1 downstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N
vg0310381006 A -> G LOC_Os03g18530-LOC_Os03g18540 intergenic_region ; MODIFIER silent_mutation Average:93.133; most accessible tissue: Callus, score: 96.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310381006 A G -0.03 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310381006 NA 2.30E-60 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 2.94E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 2.23E-52 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 3.29E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 2.08E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.30E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 5.87E-74 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.47E-35 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 8.23E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.81E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 7.52E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 3.17E-27 mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 3.60E-61 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.34E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 6.11E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.45E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.02E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.23E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.26E-32 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.12E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.46E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 3.40E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.39E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.13E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.38E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 1.79E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 2.51E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 3.94E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 8.33E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 7.90E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.04E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310381006 NA 4.13E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251