\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310273738:

Variant ID: vg0310273738 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10273738
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATAAAAACATTAAATTAACACAATACGATATTAAATATTTTTTTTAAAAAAATTCTAAAATTAGAACAAGAAAAATAAGATTTCAATTAGGAATA[T/C]
AATTTATAAATAACTAAAATTTTTGATAAAAATAAAGATTATTAAAATAAAAGACCATCTAAAACACATGACGAGATATATTAAGTAATATGCCTATAAA

Reverse complement sequence

TTTATAGGCATATTACTTAATATATCTCGTCATGTGTTTTAGATGGTCTTTTATTTTAATAATCTTTATTTTTATCAAAAATTTTAGTTATTTATAAATT[A/G]
TATTCCTAATTGAAATCTTATTTTTCTTGTTCTAATTTTAGAATTTTTTTAAAAAAAATATTTAATATCGTATTGTGTTAATTTAATGTTTTTATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 17.30% 26.94% 19.61% NA
All Indica  2759 2.20% 26.00% 39.98% 31.90% NA
All Japonica  1512 94.20% 2.80% 2.45% 0.60% NA
Aus  269 65.40% 8.90% 18.59% 7.06% NA
Indica I  595 1.00% 14.60% 28.07% 56.30% NA
Indica II  465 0.60% 13.30% 41.94% 44.09% NA
Indica III  913 3.60% 41.10% 46.44% 8.87% NA
Indica Intermediate  786 2.30% 24.40% 40.33% 32.95% NA
Temperate Japonica  767 97.50% 0.00% 1.96% 0.52% NA
Tropical Japonica  504 89.30% 7.90% 2.38% 0.40% NA
Japonica Intermediate  241 93.80% 0.80% 4.15% 1.24% NA
VI/Aromatic  96 5.20% 28.10% 66.67% 0.00% NA
Intermediate  90 46.70% 11.10% 21.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310273738 T -> C LOC_Os03g18320.1 upstream_gene_variant ; 1964.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18330.1 upstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18340.1 upstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18310.1 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18310.3 downstream_gene_variant ; 4350.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18310.2 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> C LOC_Os03g18320-LOC_Os03g18330 intergenic_region ; MODIFIER silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0310273738 T -> DEL N N silent_mutation Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310273738 NA 1.25E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.32E-43 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.18E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 7.42E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.29E-41 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.32E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.65E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 9.20E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.22E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.73E-24 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.33E-38 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 9.30E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.11E-55 mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 7.22E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.03E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 7.77E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.95E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 5.20E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 6.02E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 3.25E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.90E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.04E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 5.14E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 5.12E-37 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.42E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 3.59E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 2.87E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.04E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.36E-29 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.15E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.37E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 3.31E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 1.87E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738 NA 8.11E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251