Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310273738:

Variant ID: vg0310273738 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10273738
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAATAAAAACATTAAATTAACACAATACGATATTAAATATTTTTTTTAAAAAAATTCTAAAATTAGAACAAGAAAAATAAGATTTCAATTAGGAATA[T/C]
AATTTATAAATAACTAAAATTTTTGATAAAAATAAAGATTATTAAAATAAAAGACCATCTAAAACACATGACGAGATATATTAAGTAATATGCCTATAAA

Reverse complement sequence

TTTATAGGCATATTACTTAATATATCTCGTCATGTGTTTTAGATGGTCTTTTATTTTAATAATCTTTATTTTTATCAAAAATTTTAGTTATTTATAAATT[A/G]
TATTCCTAATTGAAATCTTATTTTTCTTGTTCTAATTTTAGAATTTTTTTAAAAAAAATATTTAATATCGTATTGTGTTAATTTAATGTTTTTATTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	17.30%	26.94%	19.61%	NA
All Indica	2759	2.20%	26.00%	39.98%	31.90%	NA
All Japonica	1512	94.20%	2.80%	2.45%	0.60%	NA
Aus	269	65.40%	8.90%	18.59%	7.06%	NA
Indica I	595	1.00%	14.60%	28.07%	56.30%	NA
Indica II	465	0.60%	13.30%	41.94%	44.09%	NA
Indica III	913	3.60%	41.10%	46.44%	8.87%	NA
Indica Intermediate	786	2.30%	24.40%	40.33%	32.95%	NA
Temperate Japonica	767	97.50%	0.00%	1.96%	0.52%	NA
Tropical Japonica	504	89.30%	7.90%	2.38%	0.40%	NA
Japonica Intermediate	241	93.80%	0.80%	4.15%	1.24%	NA
VI/Aromatic	96	5.20%	28.10%	66.67%	0.00%	NA
Intermediate	90	46.70%	11.10%	21.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310273738	T -> C	LOC_Os03g18320.1	upstream_gene_variant ; 1964.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18330.1	upstream_gene_variant ; 1138.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18340.1	upstream_gene_variant ; 3304.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18310.1	downstream_gene_variant ; 2565.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18310.3	downstream_gene_variant ; 4350.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18310.2	downstream_gene_variant ; 2565.0bp to feature; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> C	LOC_Os03g18320-LOC_Os03g18330	intergenic_region ; MODIFIER	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0310273738	T -> DEL	N	N	silent_mutation	Average:14.833; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310273738	NA	1.25E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.32E-43	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.18E-11	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	7.42E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.29E-41	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.32E-26	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.65E-30	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	9.20E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.22E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.73E-24	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.33E-38	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	9.30E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.11E-55	mr1599	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	7.22E-10	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.03E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	7.77E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.95E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	5.20E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	6.02E-31	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	3.25E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.90E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.04E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	5.14E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	5.12E-37	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.42E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	3.59E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	2.87E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.04E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.36E-29	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.15E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.37E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	3.31E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	1.87E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310273738	NA	8.11E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251