Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310223480:

Variant ID: vg0310223480 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10223480
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCGGCTGCTCCCGCTGGTTTTCTGGTTCCCCAGTGGCACTTGATGACTTGAACGAACTACACCAGGAAGCATCGGGCGCTCCGTTCCGAGAGAGAGAG[A/G]
GAGAGAGAGAGAGAGATATCGCGGTATAGCAGCGCGCTGCGAGTTGTGGTTAGGTGCTCAGCCGTCACGATCCGACGAGCCGGCATAGTTGCATGAAAGG

Reverse complement sequence

CCTTTCATGCAACTATGCCGGCTCGTCGGATCGTGACGGCTGAGCACCTAACCACAACTCGCAGCGCGCTGCTATACCGCGATATCTCTCTCTCTCTCTC[T/C]
CTCTCTCTCTCGGAACGGAGCGCCCGATGCTTCCTGGTGTAGTTCGTTCAAGTCATCAAGTGCCACTGGGGAACCAGAAAACCAGCGGGAGCAGCCGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.30% 0.50% 0.25% 0.00% NA
All Indica  2759 98.90% 0.70% 0.36% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.80% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310223480 A -> G LOC_Os03g18220.1 upstream_gene_variant ; 2732.0bp to feature; MODIFIER N Average:93.815; most accessible tissue: Callus, score: 98.099 N N N N
vg0310223480 A -> G LOC_Os03g18230.1 upstream_gene_variant ; 547.0bp to feature; MODIFIER N Average:93.815; most accessible tissue: Callus, score: 98.099 N N N N
vg0310223480 A -> G LOC_Os03g18220.2 upstream_gene_variant ; 2732.0bp to feature; MODIFIER N Average:93.815; most accessible tissue: Callus, score: 98.099 N N N N
vg0310223480 A -> G LOC_Os03g18220-LOC_Os03g18230 intergenic_region ; MODIFIER N Average:93.815; most accessible tissue: Callus, score: 98.099 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310223480 A G -0.02 -0.01 -0.01 -0.01 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310223480 9.25E-07 1.72E-06 mr1057 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310223480 8.58E-06 8.58E-06 mr1339 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310223480 NA 5.85E-06 mr1673 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310223480 7.39E-06 7.36E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310223480 9.26E-06 9.26E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251