\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310111382:

Variant ID: vg0310111382 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10111382
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATAGACTATTTACAAAACTAATTACATAAATAAAAGCTAATTTGCGAGTCAAATTTTTTATGTCTAATTAATCTATAATTAGAGAATATTTACTGTAG[C/T]
ATCACATAGGCTAATCATGAATTAATTAGACTTAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGAGTTTTATTAATAGTCTACATTTAATAT

Reverse complement sequence

ATATTAAATGTAGACTATTAATAAAACTCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTAAGTCTAATTAATTCATGATTAGCCTATGTGAT[G/A]
CTACAGTAAATATTCTCTAATTATAGATTAATTAGACATAAAAAATTTGACTCGCAAATTAGCTTTTATTTATGTAATTAGTTTTGTAAATAGTCTATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 24.60% 4.42% 3.32% NA
All Indica  2759 88.70% 0.90% 6.49% 3.99% NA
All Japonica  1512 23.30% 72.90% 1.26% 2.58% NA
Aus  269 93.70% 2.60% 2.60% 1.12% NA
Indica I  595 85.00% 1.00% 11.43% 2.52% NA
Indica II  465 71.00% 0.20% 13.76% 15.05% NA
Indica III  913 99.10% 0.70% 0.11% 0.11% NA
Indica Intermediate  786 89.70% 1.40% 5.85% 3.05% NA
Temperate Japonica  767 1.00% 98.70% 0.13% 0.13% NA
Tropical Japonica  504 58.50% 31.00% 3.37% 7.14% NA
Japonica Intermediate  241 20.30% 78.40% 0.41% 0.83% NA
VI/Aromatic  96 90.60% 5.20% 1.04% 3.12% NA
Intermediate  90 65.60% 28.90% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310111382 C -> T LOC_Os03g18120.1 upstream_gene_variant ; 4837.0bp to feature; MODIFIER silent_mutation Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0310111382 C -> T LOC_Os03g18110.1 downstream_gene_variant ; 3356.0bp to feature; MODIFIER silent_mutation Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0310111382 C -> T LOC_Os03g18110-LOC_Os03g18120 intergenic_region ; MODIFIER silent_mutation Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0310111382 C -> DEL N N silent_mutation Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310111382 NA 3.42E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310111382 NA 8.03E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.09E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 3.19E-42 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 3.13E-43 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.23E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.31E-32 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 8.66E-32 mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.03E-07 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 6.74E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.03E-08 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 8.01E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.29E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.69E-52 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 5.11E-52 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 7.67E-52 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 9.43E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 5.87E-30 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 9.64E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382 NA 1.17E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251