Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310111382:

Variant ID: vg0310111382 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 10111382
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATAGACTATTTACAAAACTAATTACATAAATAAAAGCTAATTTGCGAGTCAAATTTTTTATGTCTAATTAATCTATAATTAGAGAATATTTACTGTAG[C/T]
ATCACATAGGCTAATCATGAATTAATTAGACTTAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGAGTTTTATTAATAGTCTACATTTAATAT

Reverse complement sequence

ATATTAAATGTAGACTATTAATAAAACTCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTAAGTCTAATTAATTCATGATTAGCCTATGTGAT[G/A]
CTACAGTAAATATTCTCTAATTATAGATTAATTAGACATAAAAAATTTGACTCGCAAATTAGCTTTTATTTATGTAATTAGTTTTGTAAATAGTCTATAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	24.60%	4.42%	3.32%	NA
All Indica	2759	88.70%	0.90%	6.49%	3.99%	NA
All Japonica	1512	23.30%	72.90%	1.26%	2.58%	NA
Aus	269	93.70%	2.60%	2.60%	1.12%	NA
Indica I	595	85.00%	1.00%	11.43%	2.52%	NA
Indica II	465	71.00%	0.20%	13.76%	15.05%	NA
Indica III	913	99.10%	0.70%	0.11%	0.11%	NA
Indica Intermediate	786	89.70%	1.40%	5.85%	3.05%	NA
Temperate Japonica	767	1.00%	98.70%	0.13%	0.13%	NA
Tropical Japonica	504	58.50%	31.00%	3.37%	7.14%	NA
Japonica Intermediate	241	20.30%	78.40%	0.41%	0.83%	NA
VI/Aromatic	96	90.60%	5.20%	1.04%	3.12%	NA
Intermediate	90	65.60%	28.90%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0310111382	C -> T	LOC_Os03g18120.1	upstream_gene_variant ; 4837.0bp to feature; MODIFIER	silent_mutation	Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0310111382	C -> T	LOC_Os03g18110.1	downstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0310111382	C -> T	LOC_Os03g18110-LOC_Os03g18120	intergenic_region ; MODIFIER	silent_mutation	Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0310111382	C -> DEL	N	N	silent_mutation	Average:50.154; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0310111382	NA	3.42E-54	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310111382	NA	8.03E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.09E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	3.19E-42	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	3.13E-43	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.23E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.31E-32	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	8.66E-32	mr1423	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.03E-07	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	6.74E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.03E-08	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	8.01E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.29E-07	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.69E-52	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	5.11E-52	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	7.67E-52	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	9.43E-40	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	5.87E-30	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	9.64E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111382	NA	1.17E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251