\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310111258:

Variant ID: vg0310111258 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10111258
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATGGAAAGTTGGAAGTTGAGGGTGAATTAAACACGGCCTTATTCGCTAGCAACTCAGGTGGTGTTTGGATCCATGGACTTAACTTTAGTCTTTATAT[T/A]
TAGACACTAATTTAGAGTATTAAATATAGACTATTTACAAAACTAATTACATAAATAAAAGCTAATTTGCGAGTCAAATTTTTTATGTCTAATTAATCTA

Reverse complement sequence

TAGATTAATTAGACATAAAAAATTTGACTCGCAAATTAGCTTTTATTTATGTAATTAGTTTTGTAAATAGTCTATATTTAATACTCTAAATTAGTGTCTA[A/T]
ATATAAAGACTAAAGTTAAGTCCATGGATCCAAACACCACCTGAGTTGCTAGCGAATAAGGCCGTGTTTAATTCACCCTCAACTTCCAACTTTCCATCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.40% 0.15% 0.00% NA
All Indica  2759 65.10% 34.70% 0.18% 0.00% NA
All Japonica  1512 74.30% 25.70% 0.00% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 71.30% 28.40% 0.34% 0.00% NA
Indica II  465 26.90% 73.10% 0.00% 0.00% NA
Indica III  913 78.10% 21.90% 0.00% 0.00% NA
Indica Intermediate  786 67.90% 31.70% 0.38% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 33.10% 66.90% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.40% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 59.40% 1.04% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310111258 T -> A LOC_Os03g18120.1 upstream_gene_variant ; 4961.0bp to feature; MODIFIER silent_mutation Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0310111258 T -> A LOC_Os03g18110.1 downstream_gene_variant ; 3232.0bp to feature; MODIFIER silent_mutation Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0310111258 T -> A LOC_Os03g18110-LOC_Os03g18120 intergenic_region ; MODIFIER silent_mutation Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310111258 NA 5.28E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111258 NA 3.74E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111258 NA 5.12E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111258 NA 1.44E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111258 1.51E-08 8.40E-10 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310111258 2.50E-07 2.79E-09 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251