\
| Variant ID: vg0310111258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 10111258 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGATGGAAAGTTGGAAGTTGAGGGTGAATTAAACACGGCCTTATTCGCTAGCAACTCAGGTGGTGTTTGGATCCATGGACTTAACTTTAGTCTTTATAT[T/A]
TAGACACTAATTTAGAGTATTAAATATAGACTATTTACAAAACTAATTACATAAATAAAAGCTAATTTGCGAGTCAAATTTTTTATGTCTAATTAATCTA
TAGATTAATTAGACATAAAAAATTTGACTCGCAAATTAGCTTTTATTTATGTAATTAGTTTTGTAAATAGTCTATATTTAATACTCTAAATTAGTGTCTA[A/T]
ATATAAAGACTAAAGTTAAGTCCATGGATCCAAACACCACCTGAGTTGCTAGCGAATAAGGCCGTGTTTAATTCACCCTCAACTTCCAACTTTCCATCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 31.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 65.10% | 34.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.30% | 28.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 26.90% | 73.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.90% | 31.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 59.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0310111258 | T -> A | LOC_Os03g18120.1 | upstream_gene_variant ; 4961.0bp to feature; MODIFIER | silent_mutation | Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0310111258 | T -> A | LOC_Os03g18110.1 | downstream_gene_variant ; 3232.0bp to feature; MODIFIER | silent_mutation | Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0310111258 | T -> A | LOC_Os03g18110-LOC_Os03g18120 | intergenic_region ; MODIFIER | silent_mutation | Average:55.529; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0310111258 | NA | 5.28E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310111258 | NA | 3.74E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310111258 | NA | 5.12E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310111258 | NA | 1.44E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310111258 | 1.51E-08 | 8.40E-10 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310111258 | 2.50E-07 | 2.79E-09 | mr1498_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |