Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310101976:

Variant ID: vg0310101976 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10101976
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTATTGATGAGGGTTATTTGGGTCATTTTTACTCCCCACTAAATTTGCCTTGGGATGTTAGGAATCTTTTTTTTTAGGACAGAGGGAGTACGAGTTAT[T/C]
GATAGAAATAGATGGACTCATAGAATGAGTGCTTTCGTCACTTTGTTCCATTTCCACCCAAGTACGGGAAATGAGAGGCCATGCTAACTCTCAGTTTTAA

Reverse complement sequence

TTAAAACTGAGAGTTAGCATGGCCTCTCATTTCCCGTACTTGGGTGGAAATGGAACAAAGTGACGAAAGCACTCATTCTATGAGTCCATCTATTTCTATC[A/G]
ATAACTCGTACTCCCTCTGTCCTAAAAAAAAAGATTCCTAACATCCCAAGGCAAATTTAGTGGGGAGTAAAAATGACCCAAATAACCCTCATCAATAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 24.20% 0.00% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 27.20% 72.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 69.00% 31.00% 0.00% 0.00% NA
Japonica Intermediate  241 22.00% 78.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310101976 T -> C LOC_Os03g18080.1 upstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N
vg0310101976 T -> C LOC_Os03g18110.1 upstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N
vg0310101976 T -> C LOC_Os03g18080.2 upstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N
vg0310101976 T -> C LOC_Os03g18090.1 downstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N
vg0310101976 T -> C LOC_Os03g18100.1 downstream_gene_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N
vg0310101976 T -> C LOC_Os03g18090-LOC_Os03g18100 intergenic_region ; MODIFIER silent_mutation Average:56.718; most accessible tissue: Minghui63 flower, score: 85.758 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0310101976 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310101976 NA 9.97E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310101976 NA 2.14E-72 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 5.63E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 5.02E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 4.25E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 3.89E-44 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 5.78E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 2.82E-06 8.71E-32 mr1423 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 6.63E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 4.55E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 5.92E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 1.68E-74 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 4.01E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 5.69E-51 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 3.38E-50 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 3.77E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310101976 NA 1.34E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251