\
| Variant ID: vg0310049531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 10049531 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTATTCTAATTAAATGCATGCATAGATTGAATTTATCCGAGTGATCCAAATGAAAAGGTAATAATAATAATTTCTGGGTCTTTACGTTAGTTATGGTT[G/A]
TGCCTTATATTTTGGGATGGATGAAATATCGTTTTAGACATAATATCATTTACCAACAATTAATTAATTAAATTAGGTGGTTGTGTGTTTTATGACAGAA
TTCTGTCATAAAACACACAACCACCTAATTTAATTAATTAATTGTTGGTAAATGATATTATGTCTAAAACGATATTTCATCCATCCCAAAATATAAGGCA[C/T]
AACCATAACTAACGTAAAGACCCAGAAATTATTATTATTACCTTTTCATTTGGATCACTCGGATAAATTCAATCTATGCATGCATTTAATTAGAATAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 6.70% | 1.21% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 76.90% | 19.60% | 3.51% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 0.10% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 45.20% | 52.60% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 12.90% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0310049531 | G -> A | LOC_Os03g18040.1 | downstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:34.85; most accessible tissue: Callus, score: 70.714 | N | N | N | N |
| vg0310049531 | G -> A | LOC_Os03g18040-LOC_Os03g18050 | intergenic_region ; MODIFIER | silent_mutation | Average:34.85; most accessible tissue: Callus, score: 70.714 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0310049531 | NA | 6.75E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 3.81E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 1.66E-11 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 1.84E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 7.94E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 2.85E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | 3.93E-11 | 1.02E-21 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | 9.89E-06 | 1.69E-10 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 2.92E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 3.47E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 1.21E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 3.63E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 2.56E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 1.81E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 3.35E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | 1.83E-08 | 3.60E-25 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310049531 | NA | 3.03E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |