\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309968802:

Variant ID: vg0309968802 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9968802
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCACATCACATGCAACAAATATATATCCTTATGCCATGTCATTAATTATTATAGATTTGAAGAATATGTTTATTTGATATTTTAAAATAGGCAAAATT[G/A,T]
GTTATATAGCATCGAAAGTTCACGTTTTTAGTTTTATAGTACCGAAAGTTACCGGTTCACTTTAATAGCATCAAAAGTTCACCCTGTTCCCATTTTTAGC

Reverse complement sequence

GCTAAAAATGGGAACAGGGTGAACTTTTGATGCTATTAAAGTGAACCGGTAACTTTCGGTACTATAAAACTAAAAACGTGAACTTTCGATGCTATATAAC[C/T,A]
AATTTTGCCTATTTTAAAATATCAAATAAACATATTCTTCAAATCTATAATAATTAATGACATGGCATAAGGATATATATTTGTTGCATGTGATGTGCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 6.50% 0.74% 0.00% T: 0.06%
All Indica  2759 99.90% 0.10% 0.00% 0.00% T: 0.04%
All Japonica  1512 78.40% 19.40% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.00% 0.00% T: 0.13%
Temperate Japonica  767 97.40% 0.50% 2.09% 0.00% NA
Tropical Japonica  504 44.40% 53.00% 2.58% 0.00% NA
Japonica Intermediate  241 89.20% 9.10% 1.66% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 0.00% T: 2.08%
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309968802 G -> T LOC_Os03g17900.1 upstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N
vg0309968802 G -> T LOC_Os03g17890.1 downstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N
vg0309968802 G -> T LOC_Os03g17890-LOC_Os03g17900 intergenic_region ; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N
vg0309968802 G -> A LOC_Os03g17900.1 upstream_gene_variant ; 3693.0bp to feature; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N
vg0309968802 G -> A LOC_Os03g17890.1 downstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N
vg0309968802 G -> A LOC_Os03g17890-LOC_Os03g17900 intergenic_region ; MODIFIER silent_mutation Average:29.487; most accessible tissue: Callus, score: 60.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309968802 NA 7.62E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 1.63E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 1.76E-11 5.51E-21 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 1.44E-07 2.77E-10 mr1871 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 1.75E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 2.16E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 1.09E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 2.03E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 1.93E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 3.80E-06 2.04E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309968802 NA 2.30E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251