\
| Variant ID: vg0309968802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9968802 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCACATCACATGCAACAAATATATATCCTTATGCCATGTCATTAATTATTATAGATTTGAAGAATATGTTTATTTGATATTTTAAAATAGGCAAAATT[G/A,T]
GTTATATAGCATCGAAAGTTCACGTTTTTAGTTTTATAGTACCGAAAGTTACCGGTTCACTTTAATAGCATCAAAAGTTCACCCTGTTCCCATTTTTAGC
GCTAAAAATGGGAACAGGGTGAACTTTTGATGCTATTAAAGTGAACCGGTAACTTTCGGTACTATAAAACTAAAAACGTGAACTTTCGATGCTATATAAC[C/T,A]
AATTTTGCCTATTTTAAAATATCAAATAAACATATTCTTCAAATCTATAATAATTAATGACATGGCATAAGGATATATATTTGTTGCATGTGATGTGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 6.50% | 0.74% | 0.00% | T: 0.06% |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 78.40% | 19.40% | 2.18% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.00% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 97.40% | 0.50% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 44.40% | 53.00% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 9.10% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 0.00% | T: 2.08% |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309968802 | G -> T | LOC_Os03g17900.1 | upstream_gene_variant ; 3693.0bp to feature; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| vg0309968802 | G -> T | LOC_Os03g17890.1 | downstream_gene_variant ; 3021.0bp to feature; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| vg0309968802 | G -> T | LOC_Os03g17890-LOC_Os03g17900 | intergenic_region ; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| vg0309968802 | G -> A | LOC_Os03g17900.1 | upstream_gene_variant ; 3693.0bp to feature; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| vg0309968802 | G -> A | LOC_Os03g17890.1 | downstream_gene_variant ; 3021.0bp to feature; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| vg0309968802 | G -> A | LOC_Os03g17890-LOC_Os03g17900 | intergenic_region ; MODIFIER | silent_mutation | Average:29.487; most accessible tissue: Callus, score: 60.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309968802 | NA | 7.62E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 1.63E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | 1.76E-11 | 5.51E-21 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | 1.44E-07 | 2.77E-10 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 1.75E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 2.16E-08 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 1.09E-06 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 2.03E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 1.93E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | 3.80E-06 | 2.04E-20 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309968802 | NA | 2.30E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |