\
| Variant ID: vg0309414251 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9414251 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 105. )
CATCATAATTTTAAATTTTGCAATAAGTTTACAAAACTACAAATATGTAGTATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATAT[C/T]
AAATTTTAGTTATTTGTAAATTATATATATTCCTATATCTACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAATTCCGAATTTTCTGTAAATTGTATT
AATACAATTTACAGAAAATTCGGAATTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTAGATATAGGAATATATATAATTTACAAATAACTAAAATTT[G/A]
ATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATACTACATATTTGTAGTTTTGTAAACTTATTGCAAAATTTAAAATTATGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 7.70% | 3.17% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 5.60% | 4.86% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 24.90% | 72.10% | 2.97% | 0.00% | NA |
| Indica I | 595 | 80.20% | 10.60% | 9.24% | 0.00% | NA |
| Indica II | 465 | 95.90% | 1.90% | 2.15% | 0.00% | NA |
| Indica III | 913 | 96.80% | 2.00% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 8.30% | 7.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309414251 | C -> T | LOC_Os03g16940.1 | downstream_gene_variant ; 4612.0bp to feature; MODIFIER | silent_mutation | Average:31.734; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0309414251 | C -> T | LOC_Os03g16920.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.734; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309414251 | NA | 1.48E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.68E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 4.53E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 4.36E-06 | mr1217 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 3.13E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.16E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | 6.21E-06 | NA | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 2.06E-06 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 3.00E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.66E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.37E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.69E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 6.33E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 2.61E-06 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 2.59E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 2.38E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 2.07E-06 | mr1789 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | 3.54E-07 | 3.54E-07 | mr1845 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 8.52E-07 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309414251 | NA | 1.09E-06 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |