\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309399006:

Variant ID: vg0309399006 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9399006
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGACTGGATGTCGGAAGGGGTTTTCGGATACGAATGAAAAAACTAATTTCAGAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGACTAATTAAGC[T/C]
GTCATTAGCACATGTGGGTTACTGTAGCATTTATGACTAATCACGGACTAATTAGTCTTAAAAGATTCGTCTCGCGATTTCCCCCATAACTATGCAATTA

Reverse complement sequence

TAATTGCATAGTTATGGGGGAAATCGCGAGACGAATCTTTTAAGACTAATTAGTCCGTGATTAGTCATAAATGCTACAGTAACCCACATGTGCTAATGAC[A/G]
GCTTAATTAGTCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTCTGAAATTAGTTTTTTCATTCGTATCCGAAAACCCCTTCCGACATCCAGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 6.10% 1.35% 33.16% NA
All Indica  2759 49.10% 0.10% 2.14% 48.68% NA
All Japonica  1512 81.60% 17.50% 0.13% 0.79% NA
Aus  269 25.30% 1.90% 1.12% 71.75% NA
Indica I  595 18.20% 0.00% 6.89% 74.96% NA
Indica II  465 77.20% 0.00% 0.43% 22.37% NA
Indica III  913 52.10% 0.10% 0.44% 47.32% NA
Indica Intermediate  786 52.30% 0.30% 1.53% 45.93% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 49.80% 49.00% 0.20% 0.99% NA
Japonica Intermediate  241 91.30% 6.20% 0.00% 2.49% NA
VI/Aromatic  96 83.30% 9.40% 0.00% 7.29% NA
Intermediate  90 81.10% 5.60% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309399006 T -> C LOC_Os03g16900.1 upstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:87.434; most accessible tissue: Minghui63 flag leaf, score: 96.518 N N N N
vg0309399006 T -> C LOC_Os03g16910.1 upstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:87.434; most accessible tissue: Minghui63 flag leaf, score: 96.518 N N N N
vg0309399006 T -> C LOC_Os03g16910.2 upstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:87.434; most accessible tissue: Minghui63 flag leaf, score: 96.518 N N N N
vg0309399006 T -> C LOC_Os03g16900-LOC_Os03g16910 intergenic_region ; MODIFIER silent_mutation Average:87.434; most accessible tissue: Minghui63 flag leaf, score: 96.518 N N N N
vg0309399006 T -> DEL N N silent_mutation Average:87.434; most accessible tissue: Minghui63 flag leaf, score: 96.518 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0309399006 T C -0.01 -0.01 -0.02 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309399006 NA 5.23E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309399006 NA 1.17E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309399006 NA 1.30E-13 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309399006 1.19E-06 1.19E-06 mr1524 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309399006 NA 5.41E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309399006 NA 2.15E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251