\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309318200:

Variant ID: vg0309318200 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9318200
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAATCGAAAGAAATAGATGCTCTGTTCAGTCACTAAAACCAATCTTTTGGATTTACCTCTAGTCGAGTGACTTAATTTTTAAGCTCGAATATGTTCTA[T/G]
TATTCATGTTGGATAATTCAAATTGTACTAGTAATTTATTTTATAAACTATACTTCTACCATCTACTCCTCCATCCTATAATATAGCAACTTATTACGGG

Reverse complement sequence

CCCGTAATAAGTTGCTATATTATAGGATGGAGGAGTAGATGGTAGAAGTATAGTTTATAAAATAAATTACTAGTACAATTTGAATTATCCAACATGAATA[A/C]
TAGAACATATTCGAGCTTAAAAATTAAGTCACTCGACTAGAGGTAAATCCAAAAGATTGGTTTTAGTGACTGAACAGAGCATCTATTTCTTTCGATTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 5.80% 3.17% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 72.90% 17.60% 9.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 50.10% 33.10% 16.82% 0.00% NA
Tropical Japonica  504 98.80% 0.00% 1.19% 0.00% NA
Japonica Intermediate  241 91.30% 5.00% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309318200 T -> G LOC_Os03g16800.1 upstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:65.563; most accessible tissue: Minghui63 flower, score: 80.659 N N N N
vg0309318200 T -> G LOC_Os03g16800.2 upstream_gene_variant ; 1812.0bp to feature; MODIFIER silent_mutation Average:65.563; most accessible tissue: Minghui63 flower, score: 80.659 N N N N
vg0309318200 T -> G LOC_Os03g16800-LOC_Os03g16812 intergenic_region ; MODIFIER silent_mutation Average:65.563; most accessible tissue: Minghui63 flower, score: 80.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309318200 NA 1.15E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309318200 3.10E-07 NA mr1181_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309318200 8.87E-07 8.87E-07 mr1181_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251