Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309123433:

Variant ID: vg0309123433 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 9123433
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTATGATGGAGCTGGGGAAAAAACATGAGAACTTTTGTGTCTATGGTTAATTTTGTTTTGGCAGATCCTAGTGAAGCACTTCTGTTCTGTTTTGGGG[T/C]
TATCCTGTCCAAGACATACTCTTATATTGGCAGCACTCAATGATGTATATATGTCTAGCTTTCTTTTGCTATCTTGAAAGCAAAACTTCAGGGACAAAAT

Reverse complement sequence

ATTTTGTCCCTGAAGTTTTGCTTTCAAGATAGCAAAAGAAAGCTAGACATATATACATCATTGAGTGCTGCCAATATAAGAGTATGTCTTGGACAGGATA[A/G]
CCCCAAAACAGAACAGAAGTGCTTCACTAGGATCTGCCAAAACAAAATTAACCATAGACACAAAAGTTCTCATGTTTTTTCCCCAGCTCCATCATACTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	4.30%	1.23%	0.06%	NA
All Indica	2759	98.30%	1.40%	0.33%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	26.40%	55.80%	16.73%	1.12%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.50%	1.10%	0.44%	0.00%	NA
Indica Intermediate	786	95.70%	3.70%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	88.50%	8.30%	3.12%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0309123433	T -> C	LOC_Os03g16540.1	downstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0309123433	T -> C	LOC_Os03g16550.1	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0309123433	T -> C	LOC_Os03g16540-LOC_Os03g16550	intergenic_region ; MODIFIER	silent_mutation	Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg0309123433	T -> DEL	N	N	silent_mutation	Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0309123433	NA	3.34E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	4.70E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	7.72E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	6.06E-12	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	4.63E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	5.68E-06	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	NA	3.21E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	4.30E-06	NA	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309123433	1.78E-08	NA	mr1248_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251