\
| Variant ID: vg0309123433 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9123433 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 300. )
CAAGTATGATGGAGCTGGGGAAAAAACATGAGAACTTTTGTGTCTATGGTTAATTTTGTTTTGGCAGATCCTAGTGAAGCACTTCTGTTCTGTTTTGGGG[T/C]
TATCCTGTCCAAGACATACTCTTATATTGGCAGCACTCAATGATGTATATATGTCTAGCTTTCTTTTGCTATCTTGAAAGCAAAACTTCAGGGACAAAAT
ATTTTGTCCCTGAAGTTTTGCTTTCAAGATAGCAAAAGAAAGCTAGACATATATACATCATTGAGTGCTGCCAATATAAGAGTATGTCTTGGACAGGATA[A/G]
CCCCAAAACAGAACAGAAGTGCTTCACTAGGATCTGCCAAAACAAAATTAACCATAGACACAAAAGTTCTCATGTTTTTTCCCCAGCTCCATCATACTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 4.30% | 1.23% | 0.06% | NA |
| All Indica | 2759 | 98.30% | 1.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 26.40% | 55.80% | 16.73% | 1.12% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 3.70% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 8.30% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309123433 | T -> C | LOC_Os03g16540.1 | downstream_gene_variant ; 157.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0309123433 | T -> C | LOC_Os03g16550.1 | downstream_gene_variant ; 393.0bp to feature; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0309123433 | T -> C | LOC_Os03g16540-LOC_Os03g16550 | intergenic_region ; MODIFIER | silent_mutation | Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0309123433 | T -> DEL | N | N | silent_mutation | Average:33.948; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309123433 | NA | 3.34E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 4.70E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 7.72E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 6.06E-12 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 4.63E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 5.68E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | NA | 3.21E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | 4.30E-06 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309123433 | 1.78E-08 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |