Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309108474:

Variant ID: vg0309108474 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 9108474
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.20, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TCATACATAAAGGTAGTGCTGGTCGGTGACAGAGCATCCTCTACAAAGATATGTGGACGACTCAGGTCATCATCATCTAACCCCAAAGCTGCAGCAAACT[G/A]
TGCCATAGAAACCCTATACTGCTGCCCTTGAATGGTCCACTTCACAAAATCAAGCCCCTTCTTAGTGGTGCCAAAGAAAGCAGTGGAGTAGAACTGTCCA

Reverse complement sequence

TGGACAGTTCTACTCCACTGCTTTCTTTGGCACCACTAAGAAGGGGCTTGATTTTGTGAAGTGGACCATTCAAGGGCAGCAGTATAGGGTTTCTATGGCA[C/T]
AGTTTGCTGCAGCTTTGGGGTTAGATGATGATGACCTGAGTCGTCCACATATCTTTGTAGAGGATGCTCTGTCACCGACCAGCACTACCTTTATGTATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	47.20%	1.35%	0.08%	NA
All Indica	2759	26.80%	70.90%	2.17%	0.14%	NA
All Japonica	1512	99.10%	0.80%	0.07%	0.00%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	64.50%	31.90%	3.53%	0.00%	NA
Indica II	465	9.20%	87.70%	2.58%	0.43%	NA
Indica III	913	14.60%	85.00%	0.44%	0.00%	NA
Indica Intermediate	786	22.90%	73.90%	2.93%	0.25%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	58.90%	37.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0309108474	G -> A	LOC_Os03g16530.1	N	stop_gained	Average:32.08; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N
vg0309108474	G -> DEL	LOC_Os03g16530.1	N	frameshift_variant	Average:32.08; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0309108474	NA	1.42E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	3.72E-09	mr1188	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	5.90E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	8.52E-12	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	1.46E-08	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	1.05E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	1.40E-07	mr1188_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	4.27E-10	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309108474	NA	1.14E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251