\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309107671:

Variant ID: vg0309107671 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9107671
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCCATCAGAAGGAATGATCTCAGTGTCGCCAGAGTGAGGAGAGTCGATGTCTTGCCCGGCGGCATCCACTGCCTCATTGGGATCTGTAGGAGCATTCT[C/T]
AGTAGGGGCATCTGACTCCTCATCATCACTGCTCTCCTCGGAGTGAGAGGACTCCTCATTAAAGAAACGAGAAGTGCCAGAGGGACCCTCATCACTAGCA

Reverse complement sequence

TGCTAGTGATGAGGGTCCCTCTGGCACTTCTCGTTTCTTTAATGAGGAGTCCTCTCACTCCGAGGAGAGCAGTGATGATGAGGAGTCAGATGCCCCTACT[G/A]
AGAATGCTCCTACAGATCCCAATGAGGCAGTGGATGCCGCCGGGCAAGACATCGACTCTCCTCACTCTGGCGACACTGAGATCATTCCTTCTGATGGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.10% 0.66% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 91.50% 6.50% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 83.60% 12.50% 3.91% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309107671 C -> T LOC_Os03g16530.1 missense_variant ; p.Glu2074Lys; MODERATE nonsynonymous_codon ; E2074K Average:23.963; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 unknown unknown TOLERATED 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309107671 NA 2.03E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 2.97E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 1.74E-09 mr1712 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 8.66E-07 mr1946 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 2.47E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 2.21E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 7.64E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309107671 NA 2.32E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251