Variant ID: vg0309107671 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 9107671 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGCCATCAGAAGGAATGATCTCAGTGTCGCCAGAGTGAGGAGAGTCGATGTCTTGCCCGGCGGCATCCACTGCCTCATTGGGATCTGTAGGAGCATTCT[C/T]
AGTAGGGGCATCTGACTCCTCATCATCACTGCTCTCCTCGGAGTGAGAGGACTCCTCATTAAAGAAACGAGAAGTGCCAGAGGGACCCTCATCACTAGCA
TGCTAGTGATGAGGGTCCCTCTGGCACTTCTCGTTTCTTTAATGAGGAGTCCTCTCACTCCGAGGAGAGCAGTGATGATGAGGAGTCAGATGCCCCTACT[G/A]
AGAATGCTCCTACAGATCCCAATGAGGCAGTGGATGCCGCCGGGCAAGACATCGACTCTCCTCACTCTGGCGACACTGAGATCATTCCTTCTGATGGCGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.20% | 2.10% | 0.66% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 91.50% | 6.50% | 1.98% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 83.60% | 12.50% | 3.91% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0309107671 | C -> T | LOC_Os03g16530.1 | missense_variant ; p.Glu2074Lys; MODERATE | nonsynonymous_codon ; E2074K | Average:23.963; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 | unknown | unknown | TOLERATED | 0.05 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0309107671 | NA | 2.03E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 2.97E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 1.74E-09 | mr1712 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 8.66E-07 | mr1946 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 2.47E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 2.21E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 7.64E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0309107671 | NA | 2.32E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |