| Variant ID: vg0309106481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9106481 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 209. )
CTGTATATGTATAACGGCTAGGTGACGTCATCTAGCCGTTACTCACAAATTTGAACTGGAAACAAGACAGGAAGTTCCGGACCTGGAAGACCGGAACTTC[C/T]
GGACTACACTTAGGAAAATCTTTTTCACAAGACCGGAACTTCTAGACCTAGAAGACAGGAAGTTCCGGACTTGCATTTTTGGACAGATGGAGTATTTGCA
TGCAAATACTCCATCTGTCCAAAAATGCAAGTCCGGAACTTCCTGTCTTCTAGGTCTAGAAGTTCCGGTCTTGTGAAAAAGATTTTCCTAAGTGTAGTCC[G/A]
GAAGTTCCGGTCTTCCAGGTCCGGAACTTCCTGTCTTGTTTCCAGTTCAAATTTGTGAGTAACGGCTAGATGACGTCACCTAGCCGTTATACATATACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 0.10% | 4.80% | 0.49% | NA |
| All Indica | 2759 | 90.80% | 0.20% | 8.19% | 0.83% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 0.00% | 6.05% | 0.84% | NA |
| Indica II | 465 | 92.50% | 0.20% | 6.24% | 1.08% | NA |
| Indica III | 913 | 90.40% | 0.30% | 8.87% | 0.44% | NA |
| Indica Intermediate | 786 | 88.50% | 0.10% | 10.18% | 1.15% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309106481 | C -> T | LOC_Os03g16530.1 | downstream_gene_variant ; 1074.0bp to feature; MODIFIER | silent_mutation | Average:28.744; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0309106481 | C -> T | LOC_Os03g16500-LOC_Os03g16530 | intergenic_region ; MODIFIER | silent_mutation | Average:28.744; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0309106481 | C -> DEL | N | N | silent_mutation | Average:28.744; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309106481 | NA | 9.45E-07 | mr1004 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | NA | 2.27E-06 | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | NA | 8.45E-07 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | NA | 1.30E-06 | mr1011 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | 7.47E-07 | 7.44E-07 | mr1012 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | 2.40E-06 | 1.52E-07 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309106481 | NA | 6.95E-06 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |