| Variant ID: vg0309093045 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9093045 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.23, others allele: 0.00, population size: 232. )
TATGTTGACTGTGGTAGGTGTTGATTGTCTCGTGTCTCCTCTCTTCCTAGGGGGTCTTGTATTTATACCCATAGGTGTCTCCTTGTCCAAGTAGAACTAG[G/T]
GAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTCCATGTAGAACTCTGGTTGTCTTTCCTTATCCGGAACTACTCCTATATCCGCATGTTATT
AATAACATGCGGATATAGGAGTAGTTCCGGATAAGGAAAGACAACCAGAGTTCTACATGGAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTC[C/A]
CTAGTTCTACTTGGACAAGGAGACACCTATGGGTATAAATACAAGACCCCCTAGGAAGAGAGGAGACACGAGACAATCAACACCTACCACAGTCAACATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.20% | 41.80% | 0.61% | 0.40% | NA |
| All Indica | 2759 | 28.60% | 69.70% | 0.94% | 0.69% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.70% | 33.90% | 1.34% | 0.00% | NA |
| Indica II | 465 | 7.30% | 89.00% | 1.51% | 2.15% | NA |
| Indica III | 913 | 15.80% | 83.80% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 28.90% | 69.10% | 1.27% | 0.76% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 33.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309093045 | G -> T | LOC_Os03g16490.1 | upstream_gene_variant ; 603.0bp to feature; MODIFIER | silent_mutation | Average:73.784; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| vg0309093045 | G -> T | LOC_Os03g16500.1 | upstream_gene_variant ; 3218.0bp to feature; MODIFIER | silent_mutation | Average:73.784; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| vg0309093045 | G -> T | LOC_Os03g16490-LOC_Os03g16500 | intergenic_region ; MODIFIER | silent_mutation | Average:73.784; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| vg0309093045 | G -> DEL | N | N | silent_mutation | Average:73.784; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309093045 | NA | 7.49E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309093045 | NA | 7.92E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309093045 | NA | 2.65E-10 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309093045 | 4.91E-06 | NA | mr1754 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |