| Variant ID: vg0308881162 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8881162 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 268. )
AAGAGTAGTTGTATTGATCTGTGTGATAAATTACATAGACCCCAGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAAA[C/T]
TTTCCTAAAGATAAAAGGAAAACATAAAGTCCTTATCGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGAT
ATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCGATAAGGACTTTATGTTTTCCTTTTATCTTTAGGAAA[G/A]
TTTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCTGGGGTCTATGTAATTTATCACACAGATCAATACAACTACTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308881162 | C -> T | LOC_Os03g16100.1 | upstream_gene_variant ; 1697.0bp to feature; MODIFIER | silent_mutation | Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0308881162 | C -> T | LOC_Os03g16110.1 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0308881162 | C -> T | LOC_Os03g16110.3 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0308881162 | C -> T | LOC_Os03g16110.2 | upstream_gene_variant ; 3004.0bp to feature; MODIFIER | silent_mutation | Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| vg0308881162 | C -> T | LOC_Os03g16090-LOC_Os03g16100 | intergenic_region ; MODIFIER | silent_mutation | Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308881162 | NA | 1.59E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 1.36E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 7.56E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 2.26E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 2.10E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 1.36E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | 3.39E-06 | NA | mr1529_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | 2.08E-06 | NA | mr1835_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308881162 | NA | 5.26E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |