Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308881162:

Variant ID: vg0308881162 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8881162
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAGTAGTTGTATTGATCTGTGTGATAAATTACATAGACCCCAGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAAA[C/T]
TTTCCTAAAGATAAAAGGAAAACATAAAGTCCTTATCGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGAT

Reverse complement sequence

ATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCGATAAGGACTTTATGTTTTCCTTTTATCTTTAGGAAA[G/A]
TTTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCTGGGGTCTATGTAATTTATCACACAGATCAATACAACTACTCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.90%	0.00%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308881162	C -> T	LOC_Os03g16100.1	upstream_gene_variant ; 1697.0bp to feature; MODIFIER	silent_mutation	Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0308881162	C -> T	LOC_Os03g16110.1	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0308881162	C -> T	LOC_Os03g16110.3	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0308881162	C -> T	LOC_Os03g16110.2	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N
vg0308881162	C -> T	LOC_Os03g16090-LOC_Os03g16100	intergenic_region ; MODIFIER	silent_mutation	Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308881162	NA	1.59E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	1.36E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	7.56E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	2.26E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	2.10E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	1.36E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	3.39E-06	NA	mr1529_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	2.08E-06	NA	mr1835_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162	NA	5.26E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251