\
| Variant ID: vg0308877969 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8877969 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACAAAAGTTGTTTTAAAAAATCATACTGATCCATTTTTTTAAAAAAATAGCTAATACTTAATTAATCACGCGCTAATGGACCGTTCCATTTTCCGTGC[G/A]
CATGTTCCGGTTGGGAACACGCTGGAGCGAACACAGCCTAATATTGGTATATAATTAAGGAAATTTCGGCTCGTACAAATTGGTTTGTGCGTTAGCACGC
GCGTGCTAACGCACAAACCAATTTGTACGAGCCGAAATTTCCTTAATTATATACCAATATTAGGCTGTGTTCGCTCCAGCGTGTTCCCAACCGGAACATG[C/T]
GCACGGAAAATGGAACGGTCCATTAGCGCGTGATTAATTAAGTATTAGCTATTTTTTTAAAAAAATGGATCAGTATGATTTTTTAAAACAACTTTTGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308877969 | G -> A | LOC_Os03g16090.1 | upstream_gene_variant ; 2568.0bp to feature; MODIFIER | silent_mutation | Average:56.855; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg0308877969 | G -> A | LOC_Os03g16100.1 | upstream_gene_variant ; 4890.0bp to feature; MODIFIER | silent_mutation | Average:56.855; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg0308877969 | G -> A | LOC_Os03g16090.2 | upstream_gene_variant ; 4588.0bp to feature; MODIFIER | silent_mutation | Average:56.855; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg0308877969 | G -> A | LOC_Os03g16090-LOC_Os03g16100 | intergenic_region ; MODIFIER | silent_mutation | Average:56.855; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308877969 | NA | 1.01E-22 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.36E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 6.35E-16 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 2.93E-22 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 5.07E-21 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 2.23E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.08E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 7.46E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.53E-10 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 5.93E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 3.40E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 2.37E-11 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.07E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.94E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.41E-28 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.04E-28 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.60E-09 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.04E-17 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.00E-20 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.49E-19 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 6.85E-23 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 4.08E-22 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.43E-06 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.51E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 5.76E-24 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.45E-09 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 2.10E-10 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | NA | 1.01E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308877969 | 1.07E-06 | NA | mr1987_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |