\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308688739:

Variant ID: vg0308688739 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8688739
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCCTCGACGGTGGTGGTCCGGTTCAGGATGTCCTCGACAGTGGCACCTCTGTCCAGTTCTGTAGGGCACGAATTGGAGCCACGGGCAGCAGCGTGGC[G/A]
CATCATCGGCAGCAACGCTTCACCGGCACCTGCGCATCACCGGCAAAAAATGAGAAGGGGCTTCACTGCCAGCAATTACTAGGACTCCATCAGCAGTGAG

Reverse complement sequence

CTCACTGCTGATGGAGTCCTAGTAATTGCTGGCAGTGAAGCCCCTTCTCATTTTTTGCCGGTGATGCGCAGGTGCCGGTGAAGCGTTGCTGCCGATGATG[C/T]
GCCACGCTGCTGCCCGTGGCTCCAATTCGTGCCCTACAGAACTGGACAGAGGTGCCACTGTCGAGGACATCCTGAACCGGACCACCACCGTCGAGGACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 9.40% 0.61% 2.64% NA
All Indica  2759 80.60% 13.80% 1.05% 4.49% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.70% 0.50% 0.17% 0.67% NA
Indica II  465 76.60% 17.40% 1.72% 4.30% NA
Indica III  913 72.00% 21.20% 1.20% 5.59% NA
Indica Intermediate  786 79.50% 13.10% 1.15% 6.23% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.50% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308688739 G -> A LOC_Os03g15760.1 missense_variant ; p.Arg181Cys; MODERATE nonsynonymous_codon ; R181C Average:69.238; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 unknown unknown DELETERIOUS 0.04
vg0308688739 G -> DEL LOC_Os03g15760.1 N frameshift_variant Average:69.238; most accessible tissue: Zhenshan97 flag leaf, score: 88.606 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308688739 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308688739 NA 3.82E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688739 NA 1.42E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688739 4.27E-07 4.01E-08 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688739 5.94E-06 1.22E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688739 9.61E-06 2.17E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688739 NA 2.51E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251