\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308688680:

Variant ID: vg0308688680 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8688680
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.47, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCTTCGCCAGCCACGCAGTGGTGGTCGGAGGTGGCCTTGCTGGCGGCCGCCAGGGAGATGTCCTCGACGGTGGTGGTCCGGTTCAGGATGTCCTCGAC[A/G]
GTGGCACCTCTGTCCAGTTCTGTAGGGCACGAATTGGAGCCACGGGCAGCAGCGTGGCGCATCATCGGCAGCAACGCTTCACCGGCACCTGCGCATCACC

Reverse complement sequence

GGTGATGCGCAGGTGCCGGTGAAGCGTTGCTGCCGATGATGCGCCACGCTGCTGCCCGTGGCTCCAATTCGTGCCCTACAGAACTGGACAGAGGTGCCAC[T/C]
GTCGAGGACATCCTGAACCGGACCACCACCGTCGAGGACATCTCCCTGGCGGCCGCCAGCAAGGCCACCTCCGACCACCACTGCGTGGCTGGCGAAGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.30% 0.08% 0.00% NA
All Indica  2759 46.40% 53.50% 0.14% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.00% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 86.10% 13.90% 0.00% 0.00% NA
Indica II  465 8.60% 91.20% 0.22% 0.00% NA
Indica III  913 43.50% 56.40% 0.11% 0.00% NA
Indica Intermediate  786 42.10% 57.60% 0.25% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308688680 A -> G LOC_Os03g15760.1 synonymous_variant ; p.Thr200Thr; LOW synonymous_codon Average:72.969; most accessible tissue: Zhenshan97 flag leaf, score: 90.181 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0308688680 A G 0.01 0.01 0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308688680 NA 3.37E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.09E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 5.79E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.20E-23 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 9.32E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 8.11E-21 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 9.53E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 3.08E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 3.49E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 3.41E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 2.66E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 2.10E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 7.40E-12 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 4.02E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.49E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 7.44E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.72E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.27E-21 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 9.57E-11 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.73E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.99E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 2.84E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 2.25E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 3.61E-28 mr1715_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 8.39E-13 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 3.30E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.38E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308688680 NA 1.55E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251