\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308662136:

Variant ID: vg0308662136 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8662136
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCAAATTATGAGCTCCTATAAACTTTAAGTATAGTAAAACACCATTCTGGACTAGAAATTGCTATACTCCATGAAGTTTTCAGAACTAATCCAAATAT[T/C]
CATGCTTAGGCTCCAATTGATTAGCATAACCGAATGTCCACGGTGAGTTTTCATTTTTCAAGGCTTTTTCAAGGTGTCATACTGTCATCTCCTCGTCTGA

Reverse complement sequence

TCAGACGAGGAGATGACAGTATGACACCTTGAAAAAGCCTTGAAAAATGAAAACTCACCGTGGACATTCGGTTATGCTAATCAATTGGAGCCTAAGCATG[A/G]
ATATTTGGATTAGTTCTGAAAACTTCATGGAGTATAGCAATTTCTAGTCCAGAATGGTGTTTTACTATACTTAAAGTTTATAGGAGCTCATAATTTGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 39.60% 0.00% 0.00% NA
All Indica  2759 48.40% 51.60% 0.00% 0.00% NA
All Japonica  1512 95.90% 4.10% 0.00% 0.00% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 85.40% 14.60% 0.00% 0.00% NA
Indica II  465 12.30% 87.70% 0.00% 0.00% NA
Indica III  913 44.50% 55.50% 0.00% 0.00% NA
Indica Intermediate  786 46.20% 53.80% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308662136 T -> C LOC_Os03g15690.1 downstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:52.986; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0308662136 T -> C LOC_Os03g15710.1 downstream_gene_variant ; 1928.0bp to feature; MODIFIER silent_mutation Average:52.986; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0308662136 T -> C LOC_Os03g15690.2 downstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:52.986; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0308662136 T -> C LOC_Os03g15700.1 intron_variant ; MODIFIER silent_mutation Average:52.986; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308662136 NA 9.36E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0308662136 NA 1.66E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 1.15E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.22E-25 mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 1.94E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.27E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 3.18E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.83E-21 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 5.03E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.41E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.26E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 7.79E-11 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 6.56E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.66E-08 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 3.39E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 2.32E-21 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 9.86E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 1.67E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 5.00E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 9.49E-24 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 1.45E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308662136 NA 7.42E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251