\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308567901:

Variant ID: vg0308567901 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8567901
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTATATGTATAGATTTGTCTTGGAAAATACTTTCATAAAAGTATACATATAGCACTTTTCAATAAATATTTTTATAGAAATAAAAAGTCAAAGTTG[T/A]
GTTTTGGAAATCGTGTCGTTGTTCTAAACGACTTCCTTTACAAGTATAGAGGGAGTATATGGTAAGAGCTGTGGACCATTTTAACTTTTAAATCTACAAT

Reverse complement sequence

ATTGTAGATTTAAAAGTTAAAATGGTCCACAGCTCTTACCATATACTCCCTCTATACTTGTAAAGGAAGTCGTTTAGAACAACGACACGATTTCCAAAAC[A/T]
CAACTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGTGCTATATGTATACTTTTATGAAAGTATTTTCCAAGACAAATCTATACATATAATTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.70% 0.49% 0.36% NA
All Indica  2759 77.60% 21.30% 0.83% 0.25% NA
All Japonica  1512 3.90% 96.10% 0.00% 0.00% NA
Aus  269 95.90% 0.70% 0.00% 3.35% NA
Indica I  595 85.70% 13.30% 1.01% 0.00% NA
Indica II  465 34.00% 65.40% 0.65% 0.00% NA
Indica III  913 95.10% 3.60% 0.88% 0.44% NA
Indica Intermediate  786 77.00% 21.90% 0.76% 0.38% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 9.30% 90.70% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 0.00% 1.04% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308567901 T -> A LOC_Os03g15560.1 upstream_gene_variant ; 544.0bp to feature; MODIFIER silent_mutation Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0308567901 T -> A LOC_Os03g15570.1 downstream_gene_variant ; 4964.0bp to feature; MODIFIER silent_mutation Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0308567901 T -> A LOC_Os03g15550-LOC_Os03g15560 intergenic_region ; MODIFIER silent_mutation Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0308567901 T -> DEL N N silent_mutation Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308567901 NA 1.58E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901 NA 7.71E-19 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901 NA 3.94E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901 NA 9.60E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901 7.77E-06 NA mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308567901 NA 8.85E-09 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251