\
| Variant ID: vg0308567901 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8567901 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 109. )
AAAATTATATGTATAGATTTGTCTTGGAAAATACTTTCATAAAAGTATACATATAGCACTTTTCAATAAATATTTTTATAGAAATAAAAAGTCAAAGTTG[T/A]
GTTTTGGAAATCGTGTCGTTGTTCTAAACGACTTCCTTTACAAGTATAGAGGGAGTATATGGTAAGAGCTGTGGACCATTTTAACTTTTAAATCTACAAT
ATTGTAGATTTAAAAGTTAAAATGGTCCACAGCTCTTACCATATACTCCCTCTATACTTGTAAAGGAAGTCGTTTAGAACAACGACACGATTTCCAAAAC[A/T]
CAACTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGTGCTATATGTATACTTTTATGAAAGTATTTTCCAAGACAAATCTATACATATAATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 44.70% | 0.49% | 0.36% | NA |
| All Indica | 2759 | 77.60% | 21.30% | 0.83% | 0.25% | NA |
| All Japonica | 1512 | 3.90% | 96.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 0.70% | 0.00% | 3.35% | NA |
| Indica I | 595 | 85.70% | 13.30% | 1.01% | 0.00% | NA |
| Indica II | 465 | 34.00% | 65.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 95.10% | 3.60% | 0.88% | 0.44% | NA |
| Indica Intermediate | 786 | 77.00% | 21.90% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 11.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308567901 | T -> A | LOC_Os03g15560.1 | upstream_gene_variant ; 544.0bp to feature; MODIFIER | silent_mutation | Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0308567901 | T -> A | LOC_Os03g15570.1 | downstream_gene_variant ; 4964.0bp to feature; MODIFIER | silent_mutation | Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0308567901 | T -> A | LOC_Os03g15550-LOC_Os03g15560 | intergenic_region ; MODIFIER | silent_mutation | Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0308567901 | T -> DEL | N | N | silent_mutation | Average:31.476; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308567901 | NA | 1.58E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308567901 | NA | 7.71E-19 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308567901 | NA | 3.94E-32 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308567901 | NA | 9.60E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308567901 | 7.77E-06 | NA | mr1497_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308567901 | NA | 8.85E-09 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |