RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0308535729:

Variant ID: vg0308535729 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8535729
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCACTATGCACTCTTCTCTAAATAACAATTAGAATATATTTATTTTCTAAGATTATTTCCATATAATATGTTATCAAGAATAATAGTTATACTTCATA[A/C]
AAATAGTATGATAATTGTCTACAAATATGTGCAGGGTCTCCACTATATGAGAATAGATGACGAAACAAAAGTCATGTAGGAGATGGAAAAAAGTGGATGG

Reverse complement sequence

CCATCCACTTTTTTCCATCTCCTACATGACTTTTGTTTCGTCATCTATTCTCATATAGTGGAGACCCTGCACATATTTGTAGACAATTATCATACTATTT[T/G]
TATGAAGTATAACTATTATTCTTGATAACATATTATATGGAAATAATCTTAGAAAATAAATATATTCTAATTGTTATTTAGAGAAGAGTGCATAGTGACT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	2.50%	0.11%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	92.10%	7.60%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	92.90%	6.90%	0.20%	0.00%	NA
Japonica Intermediate	241	68.90%	29.90%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308535729	A -> C	LOC_Os03g15530.1	upstream_gene_variant ; 2658.0bp to feature; MODIFIER	silent_mutation	Average:22.358; most accessible tissue: Callus, score: 38.111	N	N	N	N
vg0308535729	A -> C	LOC_Os03g15530-LOC_Os03g15540	intergenic_region ; MODIFIER	silent_mutation	Average:22.358; most accessible tissue: Callus, score: 38.111	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308535729	NA	1.00E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	6.59E-06	6.49E-09	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	NA	7.74E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	6.52E-08	4.78E-13	mr1117	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	NA	1.56E-10	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	9.59E-08	1.68E-10	mr1119	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	NA	1.29E-07	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	6.72E-06	5.34E-10	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	NA	3.97E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308535729	NA	1.44E-08	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 34 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0308535729:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact